can differentiated cells produce clones by regaining the potential to express genes that have been silenced?

The human GI tract has an average length of about 5 m and extends from the mouth to the anus in mammals. 17 The buccal cavity, esophagus, stomach, small intestine, and large intestine are the macroscopic compartments that are divided from one another by sphincters.

Is the digestive system considered to be external to the body?

Due to its open ends—the mouth and anus—which are both to the outside world—the alimentary canal is regarded as existing outside of the body. The mouth, pharynx, esophagus, stomach, and small and large intestines are all included in the canal.

Which of the following best describes how the digestive system works?

Digestion and absorption are the two functions of the digestive system. Food is broken down into small molecules during digestion, and these molecules are then absorbed by the body.

To know more about digestive tract visit;

https://brainly.com/question/28163067

#SPJ4

Answer:

Currents originating in low latitudes near the equator tend to carry warmer water. Currents originating in high latitudes near the north or south pole tend to carry colder water.

Explanation:

Brainiest please

The significance of the elephant transforming woodlands into grasslands is providing a habitat and food for other species that depend on grass for their survival

An ecosystem is affected by biotic and abiotic factors.

Biotic factors are the living components ofbthe ecosystem.

The process of elephants converting woodland to grassland by elephants is an example of how a biotic factor affect an ecosystem.

Therefore, the significance of the elephant transforming woodlands into grasslands is that it helps provide a habitat and food for other species that depend on grass for their survival.

Learn more about biotic factors at: https://brainly.com/question/1542938

#SPJ1

DNA: ATATACTTTGCGATGGCTATTCAGACT transcribed to  mRNA: UAUAUGAAACGCUACCGAUUAGUCUGA
Amino Acids: Ile - Met - Lys - Arg - Tyr - Pro - Leu - Ser - Stop

1. Transcription: Convert the DNA sequence to mRNA by substituting the following bases:
  A (adenine) -> U (uracil)
  T (thymine) -> A (adenine)
  C (cytosine) -> G (guanine)
  G (guanine) -> C (cytosine)
2. Translation: Start translating at the start codon (AUG). Then, read the mRNA sequence in sets of three nucleotides (codons) and convert each codon to its corresponding amino acid using the genetic code.
The given DNA sequence was transcribed into mRNA and then translated into a protein sequence. The protein sequence consists of the amino acids Ile, Met, Lys, Arg, Tyr, Pro, Leu, and Ser, followed by a stop codon.

For more information on transcription of DNA kindly visit to

https://brainly.com/question/29772733

#SPJ11

Answer;

these are used in photosynthesis altogether. light splits the water into hydrogen and oxygen. water is used to manufacture starch, soften the testa during germination, dissolve food as well. carbon dioxide is also used during photosynthesis.

Your answer is umbra......

Answer:

The lightest part of a shadow is called the penumbra however the darkest part is called the umbra

Explanation:

hope this helps

According to the problem, after many generations, green anoles were observed to have larger and stickier toe pads than earlier generations and within the same trees, green anoles now occupy the higher branches. Note that the thinnest branches are generally the highest on the tree. This means that adaptations of the green anoles allow them to cling to thinner branches than they previously could cling to.

we can conclude that the correct answer is:

A) adaptations of the green anoles allow it to cling to thinner branches than they previously could cling to.

Answer:

3330.625 kg

Explanation:

umm.......

Let us represent the heterozygous with freckles by Ff and the homozygous with no freckles by ff. Thus, we construct the following Punnet square:

From this punnet square we see that:

50% of the offspring will be heterozygous with freckles (Ff).

50% of the offspring will be homozygous with no freckles (ff).

Answer:

The 6O2 is left out.

Explanation:

The reactants has 18 oxygens but the products only has 6 oxygens. Adding 6O2 would get us to 18 oxygens on both sides.

This is not part of the equation, but energy could be considered as well.  

Answer:

the results were published in a peer-reviewed journal.

Explanation:

When the results of any study or a research is published in a well renowned and a peer reviewed journal, then the study is considered to be credible and authentic and is accepted by the intellectual society.

In the context, two young scientists are performing an experiment on the direction finding or the orientation finding abilities of the loggerhead sea turtle which are hatching under the varying magnetic fields.

The finding of these experiment or the result will be considered credible only when the results of the experiment will be published in a peer reviewed journal.

Answer:

B. Bacterial conjugation is the mechanism used by bacterial cells to share genetic information.

Explanation:

Conjugation is the process by which one bacterium transfers genetic material to another through direct contact.

Please mark brainliest and have a lovely day!

Answer:

Explanation:

Dear Neighbor,

I hope this letter finds you well. I wanted to share an idea that I believe could greatly benefit our community and your farm. Instead of planting a traditional crop in one of your large fields, I would like to propose the idea of building a wind farm. I understand that farming has been the backbone of our community for generations, but I truly believe that embracing renewable energy, such as wind power, can bring numerous advantages.

First and foremost, a wind farm would provide a sustainable and clean source of energy. By harnessing the power of wind, we can reduce our dependence on fossil fuels and contribute to the fight against climate change. This shift towards renewable energy will not only benefit us but also future generations who will inherit our land.

Additionally, a wind farm can offer you a reliable source of income. With the growing demand for clean energy, wind farms have proven to be profitable ventures for farmers across the country. By leasing a portion of your land to a wind energy company, you can generate a steady stream of income that is not solely dependent on unpredictable crop yields or market fluctuations.

Moreover, building a wind farm can contribute to our local economy. It will create job opportunities during the construction phase, and once operational, there will be a need for technicians and maintenance personnel. This can provide employment opportunities for our community members and inject new life into our local businesses.

Lastly, embracing wind energy will showcase your commitment to sustainable farming practices and environmental stewardship. It will position your farm as a leader in our community and potentially attract positive attention and support from environmentally conscious consumers.

I understand that this is a significant decision, and I encourage you to carefully consider the potential benefits. I would be more than happy to discuss this further and provide any additional information or assistance you may need. Together, we can contribute to a greener future while securing a prosperous and sustainable future for your farm.

Thank you for your time and consideration.

Sincerely,

[Your Name]

Through a bigger blood volume and a stronger contraction of the ventricles, which results in the ejection of more blood every beat, endurance exercise enhances cardiac output. Blood volume increases as a result of the increased oxygen demand. In people with Fontan-type circulation, resistance muscle training increases muscle mass and strength and is linked to improvements in the ventricular filling, stroke volume, exercise capacity, and cardiac output on CPAP.

A slower consumption of muscle glycogen and blood glucose, a larger dependence on fat oxidation, and reduced lactate generation during the exercise of a given intensity are the main metabolic effects of muscle adaptations to endurance exercise. By causing the ventricles to contract more forcefully and pump out more blood per beat, endurance training raises the cardiac output. An increase in blood volume is also prompted by the rise in oxygen demand. Resistance muscle training increases muscle mass and strength in people with Fontan-type circulation and is linked to increased ventricular filling, stroke volume, exercise capacity, and cardiac output on CPAP.

Learn more about endurance here:

https://brainly.com/question/1699068

#SPJ4

HVGR stands for High-Velocity Gravitational Radiography, a technique used in immunology to visualize and study the movement of immune cells within the lymphatic system. It involves injecting a radioactive tracer into the body, which is taken up by the lymphatic system and carried along with the flow of lymph.

The tracer emits gamma radiation, which can be detected by specialized imaging devices such as gamma cameras or positron emission tomography (PET) scanners.

By tracking the movement of the radioactive tracer, HVGR allows researchers to observe the migration patterns and dynamics of immune cells as they travel through lymphatic vessels and lymph nodes. This technique provides valuable insights into the immune response, including how immune cells interact with antigens, how they traffic between different lymphoid tissues, and how they contribute to immune surveillance and defense against pathogens.

HVGR offers a non-invasive means to study the complex network of lymphatic vessels and immune cell trafficking, providing researchers with valuable information about immune system function and potential dysregulations.

It has been particularly useful in studying conditions involving abnormal immune cell migration, such as lymphomas, autoimmune diseases, and metastatic cancer. By understanding the patterns of immune cell movement, researchers can develop targeted therapies and interventions to modulate immune responses and improve disease outcomes.

To know more about Immunology here: https://brainly.com/question/1463911

#SPJ11

Answer:

Chloroplasts

Explanation:

Answer:

Chloroplasts :)

Explanation:

Carbohydrates are broken down into glucose, absorbed by the small intestine, transported to the liver, and used for energy or stored as glycogen or fat depending on the body's needs.

Insulin is a hormone produced by the pancreas that regulates the amount of glucose in the bloodstream. If there is a high amount of glucose in the bloodstream, insulin will signal to the liver and muscle cells to absorb and store the excess glucose. If there is a low amount of glucose in the bloodstream, glucagon will signal the liver to break down the stored glycogen into glucose and release it into the bloodstream to be used for energy.

When carbohydrates are ingested, they are digested in the mouth and stomach. The carbohydrates are broken down into glucose. The glucose is absorbed by the small intestine. The glucose is then transported to the liver.

The glucose is used for energy and stored as glycogen in the liver and muscles for later use. If there is an excess of glucose, it will be stored as fat in the adipose tissue.

For more such answers on Carbohydrates

https://brainly.com/question/336775

#SPJ8

Answer:

Basically biology traces the study of the living world from ancient to modern times. Although the concept of biology as a single coherent field arose in the 19th century, the biological sciences emerged from traditions of medicine and natural history reaching back to Ayurveda, ancient Egyptian medicine, and the works of Aristotle and Galen in the ancient Greco-Roman world. This ancient work was further developed in the Middle Ages by Muslim physicians and scholars such as Avicenna. During the European Renaissance and early modern period, biological thought was revolutionized in Europe by a renewed interest in empiricism and the discovery of many novel organisms

Explanation:

Answer:

Basically biology traces the study of the living world from ancient to modern times. Although the concept of biology as a single coherent field arose in the 19th century, the biological sciences emerged from traditions of medicine and natural history reaching back to Ayurveda, ancient Egyptian medicine, and the works of Aristotle and Galen in the ancient Greco-Roman world. This ancient work was further developed in the Middle Ages by Muslim physicians and scholars such as Avicenna. During the European Renaissance and early modern period, biological thought was revolutionized in Europe by a renewed interest in empiricism and the discovery of many novel organisms

Answer: igneous, sedimentary, and metamorphic.

Explanation: Igneous rocks form when molten rock

Sedimentary rocks form  when particles settle out of water or air, or by precipitation of minerals from water

Metamorphic rocks form under extreme heat or pressure

Answer: It depends on the genotype of the parents. If one or more parent is TT, than all offspring will be tall. If both parents are Tt, than 75% of offspring will be tall, and 25% will be short.

Explanation:

Answer:

Explanation:

Molecules are made of atoms, the smallest unit of chemical elements. They can be found in all matter, living and non-living

An organ system is a group of organs that work together to perform specific bodily functions. The respiratory system, for example, uses the lungs, airways and respiratory muscles to inhale oxygen and release carbon dioxide in animals.

Answer:

D. Hydrolysis

Explanation:

Dehydration synthesis reactions build molecules up and generally require energy, while hydrolysis reactions break molecules down and generally release energy. Carbohydrates, proteins, and nucleic acids are built up and broken down via these types of reactions, although the monomers involved are different in each case.

I hope this helps have a great day :)

The process that breaks down nucleic acids into nucleotides is hydrolysis. The correct option is d.

Any chemical reaction in which a water molecule breaks one or more chemical bonds is known as hydrolysis.

When water is the nucleophile, the phrase is used generically to refer to substitution, elimination, and solvation processes.

Nucleo depolymerase is another name for nuclease. By cleaving the phosphodiester bond that connects the nucleotides in the nucleic acids, the nucleic acid is broken down into nucleotides.

Either an enzyme or a non-enzyme can cleave the nucleic acid chain. Since the initial step in the alkaline hydrolysis of a polynucleotide is the transfer of the bond from C5' of the subsequent nucleotide to C2' of the same nucleotide, a 2'-OH group is necessary.

Thus, the correct option is d.

For more details regarding hydrolysis, visit:

https://brainly.com/question/29439050

#SPJ6

Methane purification involves removing propane and other impurities through a two-step process: adsorption and cryogenic distillation.

In the first step, adsorption, impure methane gas is passed through a bed of adsorbent material, such as activated carbon or zeolite. This material selectively adsorbs (traps) propane and other heavier hydrocarbons, allowing the purified methane to pass through. In the second step, cryogenic distillation, the gas mixture is cooled to extremely low temperatures. At these temperatures, propane and other impurities will condense into a liquid, while methane remains in its gaseous state. The liquid impurities are then removed, leaving purified methane gas for further use. This process ensures that methane is effectively separated from propane and other undesired components, making it suitable for various manufacturing applications.

Know more about Methane purification here:

https://brainly.com/question/30872936

#SPJ11

Answer:

Sexual reproduction increases genetic diversion because there are two parents, unlike in asexual reproduction where there is only one.

Explanation:

During sexual reproduction, gamites come from both parents and mix together to create genes and traits for the offspring. Gamites are formed through meiosis (reduction division), in which a germ cell undergoes two fissions, resulting in the production of four gametes.

The new planet has more mass than Earth but the same radius. The mass of the astronaut will be calculated by the use of Newton's gravitational equation. The weight of the astronaut depends completely on its mass and the gravitational acceleration of the planet.

Gravitational acceleration is directly proportional to the mass of the planet and indirectly proportional to the radius of the planet. Hence, when the gravitational acceleration increases the planet's mass will increase therefore the radius will decrease. The astronaut's mass will depend on these factors.

Learn more about Gravitational acceleration, here

https://brainly.com/question/3009841

#SPJ1

The induction of SIRT1 by melatonin improves alcohol-mediated oxidative liver injury by disrupting the CRBN-YY1-CYP2E1 signaling pathway.

Here is a step-by-step explanation of the process:

Liver disease or liver disease is a medical condition that can affect liver function in the body's metabolic processes. This condition is often caused by an unhealthy diet, excessive alcohol consumption, viral infections, and unhealthy sexual practices. One of the common symptoms of the liver is yellowing of the skin and eyes. This condition, known as jaundice, is caused by the liver not being able to properly process bilirubin. As a result, bilirubin builds up in the blood and makes the skin and eyes turn yellow. Several types of liver disease can increase the risk of developing liver cancer. In addition, liver disease if left untreated can continue to damage the organ. Cirrhosis (scarring) may develop. Over time, a damaged liver will not have enough healthy tissue to function.

Learn More About Liver at https://brainly.com/question/26413451

#SPJ11

Answer:

Fat molecules contain more energy-containing bonds than simple sugars.

Explanation:

Lipids are a large group of mostly non-polar hydrophobic hydrocarbons. They include fats and oils, waxes, phospholipids and steroids. They serve many functions in living organisms such as energy storage molecules, information molecules, insulation against cold in some animals etc.

From the information provided above, lipids have 9 kilocalories per gram, 100,000 kilocalories of energy storage, and 30 to 40 days of life support time. When energy provided per gram by lipids is compared with that of either glucose or glycogen, lipids provide more than twice the energy of that of glucose or glycogen. Similarly, the energy storage capacity of lipids over 1000 times that of glucose and 50 times that of glycogen. Therefore, fat molecules (an example of lipids) contain more energy-containing bonds than simple sugars (e.g. glucose)

Answer:

Answer is B

Explanation:

Answer:

False

Explanation:

Abuse is not always easy to identify. Both the abuser and abusee may lie about what is going on and may try to conceal signs or effects. One or both may also believe that the situation is not abuse.