p.j. turnbaugh, v.k. ridaura, j.j. faith, f.e. rey, r. knight, j.i. gordon the effect of diet on the human gut microbiome: a metagenomic analysis in humanized gnotobiotic mice

Answer:

observation :- the stone hills and land lily

Inference :- the students r good seeing nature

After treatment of DNA with the ethylating agent EMS, ethylated guanine nucleotides now base pair with thymine. After 2 generations, a GC to AT mutation would be present.

In DNA, Guanine (G) always pairs with Cytosine (C) and Adenine (A) with Thymine (T). This is referred to as complementary base pairing. EMS is an ethylating agent that ethylates guanine nucleotides in DNA, causing them to base pair with thymine (T). EMS can cause transitions (purine to purine or pyrimidine to pyrimidine) by ethylating guanine or adenine. EMS can also cause transversions (purine to pyrimidine or vice versa) by ethylating cytosine. As a result, after 2 generations, a GC to AT mutation would be present.

Therefore, EMS is a mutagenic substance that induces genetic mutations by ethylating nucleotides in DNA. Mutagens are agents or substances that cause changes or mutations in DNA sequence. It is essential to note that mutations may have significant consequences for organisms and their offspring. Mutations can result in genetic disorders, cancers, and other serious health problems.

To learn more about Cytosine visit;

https://brainly.com/question/2863615

#SPJ11

b. The reaction is endothermic. Products of a specific reaction that are endothermic have more energy than the reactants.

Every chemical reaction that absorbs heat from its surroundings is an endothermic reaction. The energy that is absorbed serves as the reaction's activation energy. Examples of endothermic processes include photosynthesis, the evaporation of liquids, the melting of ice and dry ice, alkane cracking, thermal decomposition, the oxidation of ammonium chloride in water, and many others. Endothermic chemical reactions are those that ingest (or utilise) energy overall.

To know more about endothermic reaction, click here:

https://brainly.com/question/23184814

#SPJ4

When the products of a reaction have more energy than the reactants:

a. The reaction is exothermic.

b. The reaction is endothermic.

c. The reactants gave up energy.

d. The ΔH is positive.

Answer:

translocation occurs between non-homologous chromosomes.

Explanation:

The parathyroid glands regulate the amount of calcium in the blood.

This is because calcium plays a crucial role in many physiological processes, including muscle contraction, nerve function, and bone health. The parathyroid glands are small glands located near the thyroid gland in the neck and are responsible for producing parathyroid hormone (PTH).

When calcium levels in the blood are low, the parathyroid glands release PTH, which stimulates the bones to release more calcium into the blood and increases the absorption of calcium from the intestines. PTH also promotes the reabsorption of calcium in the kidneys, reducing the amount excreted in urine.

To learn more about parathyroid follow the link: https://brainly.com/question/9225070

#SPJ4

Answer:

two for meiosis I

four for meiosis II

Explanation:

Answer:

2, and 4

Explanation:

Hope this helps

This barrier is an example of Behavioral isolation.

Behavioral isolation occurs when mismatches in mating traits (signals and/or preferences) prevent mating between two species/populations.

Members of a species cannot mate because of behavioural seclusion. It is a single mechanism among many that cause speciation. This mechanism causes behavioural divergence among population members over time. This keeps happening until they are unable to reproduce. They then split off into different types.

Behavioral isolation also stops recently diverged species from mating with each other. This prevents the two species from converging to form a new species.

To know more about Behavioral isolation visit:

https://brainly.com/question/19153103

#SPJ4

Native plants in southern California are true but for only some native plants.(option c)

The statement "Native plants in southern California are naturally adapted to deal with fire" is true, but it applies to only some native plants rather than all of them. Fire has been a natural part of the ecology in California for centuries, and certain plant species have evolved specific adaptations to survive and even thrive in fire-prone environments. These plants are known as "fire-adapted" or "fire-resistant" species.

Some native plants in southern California have developed strategies to cope with fire. For example, some species have thick, fire-resistant bark that protects the main stem from heat and flames. Others have deep root systems that allow them to access water sources even during droughts or after fires. Some plants produce seeds that require heat or smoke to germinate, which means they rely on fire to trigger the next generation of growth. These adaptations enable these plant species to recover and regenerate after fires, and in some cases, fire can even stimulate their growth.

However, it's important to note that not all native plants in southern California possess these fire-adapted traits. The region is home to a diverse array of plant species, each with its own set of adaptations to different environmental conditions. While fire may be a natural occurrence in this region, not all native plants have evolved the same level of resilience to fire.

Therefore, it is incorrect to assume that all native plants in southern California are naturally adapted to deal with fire.

Learn more about native plants here:

https://brainly.com/question/27842908

#SPJ11

Answer:

Selection pressure means factors that contribute to selection which variations will provide the individual with an increase chance of surviving over others. Because of selective pressures, organisms with certain phenotypes have an advantage when it comes to survival and reproduction. Over time, this leads to evolution.

Explanation:

i hope this helps bc i think its D. not entirely sure.

Answer: C. The nucleus in an animal cell has a different primary function than in a plant cell.

Explanation:

In both plant and animal cells, the nucleus safely stores the DNA so it doesn't get damaged.

Answer:

1. A

2. A

3. i dont know

4. D

5. E

6. B

7. D

8. B

9. i think skin? i dont know

10. B

11. C

12. i dont know

13. A - i think

14. A

15. B

16.i dont know

17. A

18.D

19. D or C

20. C

To produce an IPSP, the two types of ion channels that open and cross the membrane are: negative ion channel (like Cl⁻), inside the cell and positive ion channels (like K⁺), outside the cell.

IPSP is the abbreviation for Inhibitory Post-Synaptic Potentials. It is the potential that inhibits the generation of action potential from a post-synaptic neuron. It is a temporary hyperpolarization state. This is achieved by the opening of chloride ions for their influx and opening of potassium ions channels for their outflux.

Ion channels are integral membrane proteins that allow the passage of ions through them across the membrane. They be either active or passive. There are three types of ion channels: voltage-gated, extracellular ligand-gated, and intracellular ligand-gated.

To know more about ion channels, here

brainly.com/question/14264684

#SPJ4

Answer:

Plants absorb carbon dioxide, water and sunlight to make their own food, grow and release oxygen through photosynthesis. They're a huge part in keeping our air clean.

Explanation:

Hope this helps.

The region of the chromosomes where the two copies are held together after DNA replication is known as the centromere. This region can be found near the center of the chromosome, and it plays an essential role during cell division.

Centromeres are specialized DNA sequences that help to ensure accurate chromosome segregation during mitosis and meiosis. They are responsible for organizing the chromosomes and ensuring that they are equally distributed between daughter cells. The centromere is a highly condensed chromosomal region that is made up of a variety of proteins and DNA.

It is essential for the proper assembly of the kinetochore, a structure that helps to attach the chromosome to the microtubules of the spindle apparatus during cell division. The centromere plays a crucial role in preventing chromosome loss or damage. It also helps to prevent the formation of abnormal chromosome structures that can lead to genetic diseases such as cancer. Overall, the centromere is a vital component of the chromosome and plays an essential role in ensuring proper cell division.

In conclusion, the region of the chromosomes where the two copies are held together after DNA replication is known as the centromere. It is a highly condensed chromosomal region that is essential for accurate chromosome segregation during mitosis and meiosis. It is located near the center of the chromosome and plays an important role in preventing chromosome loss or damage and ensuring proper cell division.

To learn more about chromosomes visit;

https://brainly.com/question/30077641

#SPJ11

If solution A is isotonic when compared with solution B, it means that the concentration of solutes in both solutions is the same. Therefore, solution B is also isotonic.

Hypertonic and hypotonic solutions:

If solution B had a higher concentration of solutes, it would be hypertonic, and if it had a lower concentration of solutes, it would be hypotonic. The cell membrane plays an important role in maintaining the balance of solutes between the cell and its environment. If the solution outside the cell is hypertonic, water will move out of the cell through exosmosis, causing the cell to shrink and undergo plasmolysis.

Plasmolysis is a process in which cells lose water in a hypertonic solution, causing the cell membrane to shrink away from the cell wall. Electrolytes also play a crucial role in regulating the concentration of solutes in the body. In this case, since solution A and solution B have the same concentration of solutes, they are both isotonic solutions. An isotonic solution is a solution with the same concentration of solutes as another solution.

To know more about isotonic solutions, visit:

https://brainly.com/question/28020628

#SPJ11

Acetyl-CoA builds up in the liver, where it mixes with other substances to create ketone bodies through a process called ketogenesis. Insufficient insulin production by the pancreas characterizes Type I diabetes mellitus.

Within 30 minutes after eating a meal containing carbohydrates, blood sugar levels increase. Acetyl CoA is redirected to produce ketone bodies if too much acetyl CoA is produced during the oxidation of fatty acids and the Krebs cycle is overburdened and unable to manage it. If the body's glucose levels are too low, these ketone bodies can act as a fuel source. A molecule known as acetyl-CoA (acetyl coenzyme A) is involved in a variety of metabolic processes in the metabolism of proteins, carbohydrates, and lipids.

High levels of nucleocytosolic acetyl-CoA are indicative of a "growth" or "fed" state and encourage its use for histone acetylation and lipid synthesis.

To know more about Ketogenesis click here

brainly.com/question/27755510

#SPJ4

Answer:

The answer is B

First, he should measure how long it takes for the liquid to become clear if X and Y are mixed together. Then, he should measure how long it takes if he also adds substance A to X and Y. He will find out if substance A is a catalyst.

Explanation:

Catalysts - BAMS Cohort 6 Quizlet

Answer:

I guess *yeah* according to me

Carbon dioxide is released during cellular respiration as a waste product. Cells that are capable of photosynthesis can utilize this carbon dioxide to create new carbohydrates.

The carbon cycle includes crucial processes including photosynthesis and cellular respiration. The carbon cycle refers to the procedures used in the biosphere to recycle carbon.

Carbon dioxide is released into the environment during cellular respiration, not photosynthesis, which removes it from the atmosphere.Additionally, oxygen gas is necessary to act as an electron acceptor during the process of cellular respiration.

Therefore, burning fossil fuels (coal, natural gas, and oil), solid waste, trees, and other biological materials release carbon dioxide into the atmosphere, along with some chemical reactions (e.g., manufacture of cement).

Learn more about cellular respiration here:

https://brainly.com/question/13721588

#SPJ2

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Answer:

If two species occupied the same niche, they would be competing for the exact same resources. The competitive exclusion principle states that one of the species would drive the other to extinction.

Two species would be in direct competition for the same resources if they both occupied the same niche. According to the competitive exclusion principle, one of the species would inevitably wipe out the other.

It defines how an organism or population responds to the distribution of resources and competitors.

(for instance, by growing when resources are abundant and when predators, parasites, and pathogens are scarce) and how it then modifies those same factors.

According to the competitive exclusion principle, often known as Gauss's law, two species that are vying for the same resource in the same habitat but occupy distinct niches cannot coexist at constant population values.

Two species can dwell peacefully in ecological niches without facing any rivalry. It encourages diversity and keeps the food chain in balance.

Therefore, population dynamics affected by the presence of another species with the same niche.

Learn more about niche here:

https://brainly.com/question/23854893

#SPJ2

Hebb suggested that repeated stimulation of a group of neurons leads to the formation of __Cell assemblies___, networks of nerve cells that persist even after stimulation has stopped

Neurons, also known as neurones or nerve cells, are the basic building blocks of the brain and nervous system. They are the cells in charge of receiving sensory information from the outside world, sending motor commands to our muscles, and converting and relaying electrical signals at each stage along the way.

Neurons are messengers of information. Between various brain regions and between the brain and the rest of the nervous system, information is transmitted using electrical impulses and chemical signals.

Learn more about Neurons here:

https://brainly.com/question/13061744

#SPJ4

The type of scientist best qualified to perform genetic engineering to produce more productive seeds in agriculture would be a molecular biologist, the correct option is C.

Molecular biologists specialize in studying the structure, function, and interactions of molecules within biological systems, including DNA and genes. Genetic engineering involves manipulating the genetic material of organisms, which requires a deep understanding of molecular biology principles.

Molecular biologists have the expertise to identify and isolate specific genes responsible for desired traits in crop plants, such as increased productivity or resistance to pests or diseases. They can then modify or introduce these genes into target plants to achieve the desired outcomes, the correct option is C.

To learn more about genetic follow the link:

https://brainly.com/question/28980835

#SPJ4

Answer:

one with the fewest number of genetic differences in the nucleotide sequence.

Explanation:

A cladogram is a diagram capable of showing the relationships among different species and/or group of organisms. In a cladogram, the root indicates the common ancestor, while internal nodes represent the common ancestors of each group. In consequence, this diagram can be used to establish evolutionary relationships in which the start branch points represent common ancestors shared by the organisms found in the 'branches'. Nonetheless, the length of the branches in the cladogram does not represent evolutionary distances among groups. In recent years, cladograms based on DNA sequencing data have been combined with morphological data to establish evolutionary relationships among species.

Hyde, Peretz, and Zatorre (2008) used functional magnetic resonance imaging to examine the function of the right and left auditory cortical regions in the frequency processing of melodic sequences. They found that the right auditory cortex is specialized for processing complex melodic patterns, while the left auditory cortex is specialized for processing simple melodic patterns, using functional magnetic resonance imaging.

This suggests that different brain regions are specialized for different aspects of auditory processing and that there may be a resonance between specific frequencies and specific cortical regions.

In Hyde, Peretz, and Zatorre's (2008) study, participants listened to varied melodies in complexity and frequency. The researchers found that when participants listened to complex melodies, there was increased activity in the right auditory cortex compared to when they listened to simple melodies.

In contrast, when participants listened to simple melodies, there was increased activity in the left auditory cortex. These findings suggest that the right and left auditory cortexes specialize in different aspects of melodic processing.

The right auditory cortex may be involved in processing the complex patterns of melody, while the left auditory cortex may be more involved in processing the simple patterns of melody.

Learn more about auditory: https://brainly.com/question/30455193

#SPJ11

Answer:

In South America, Darwin saw fossils of sea animals high in the mountains.

Explanation:

Answer:

Because glucose is used by plants for energy and to make other substances like cellulose and starch. Cellulose is used in building cell walls. Starch is stored in seeds and other plant parts as a food source. That's why some foods that we eat, like rice and grains, are packed with starch.

Explanation:

Sugars facilitate the assimilation of nutrient elements and their transport by the plant since they reduce osmotic pressure, thus improving their entry into plant tissues. During vegetative development, transport takes place towards the stem and root tips.

Answer:

C

Explanation:

something needs to be polar to diffuse through the plasma membrane, which the first aa is on the outside

A radula is a specialized feeding organ used to scrape material off of food for ingestion, much like a cheese grater scrapes shreds off of a block of cheese. Snails, which have this structure, they are mass feeder.

Food-mass feeders are organisms that use any parts of their body to cut or kill their prey. Examples of food-mass feeders are: Most carnivorous animals and insects.

these organism have a high potential to have maximum amount of food in one time they also use their body organs or other things to attract their food items .

They are mostly competitors and predators which pray on other organism for their food and requirement and for their energy they need a large amount of energy for their body because they have a larger body as compared to other organism.

these include top carnivores such as Tiger, big lions etc

To know more about mass feeder visit the link

https://brainly.com/question/21286756

#SPJ11