Someone drops a book on the floor, and it makes a loud noise. At that time, you turn to look at the person who dropped the book. Turning and looking at the person who dropped the book is an example of a…

A. Phototropism

B. Response

C. Hydrotropism

D. Stimulus

Lead (Pb) is able to react with different elements because it has a relatively low ionization energy, which means that it requires less energy to remove an electron from a lead atom compared to other elements.

Low ionization energy makes it more likely for lead to form compounds with other elements by giving up electrons or sharing them in covalent bonds. Additionally, lead has a relatively high atomic mass, which makes it more likely to form ionic compounds with lighter elements that have lower atomic masses.

The ability of lead to react with different elements also depends on the specific conditions under which the reaction occurs, such as temperature, pressure, and the presence of other reactants or catalysts.

Find out more on lead here: https://brainly.com/question/18110420

#SPJ1

To balance a equation, we need to have the same number of atoms of each elements on both sides of the chemical reaction (reactant and product side).

I rewrote this substance(Zn(CH3COO)2) for better understanding.

__Zn + __HC2H3O2 → __Zn(C2H3O2)2 + __H2

Reactant side unbalanced:

Zn - 1

H - 4

C - 2

O - 2

Products side unbalanced:

Zn - 1

C - 4

H - 8

O - 4

Obs: when there is a part inside the parentheses, all the atoms are multiplied by the number outside the parentheses.

Now let's balance the equation changing the stoichiometric coefficient.

Zn + 2 HC2H3O2 → Zn(C2H3O2)2 + H2

Reactant side:

Zn - 1

H - 8

C - 4

O - 4

Product side:

Zn - 1

H - 8

C - 4

O - 4

Now the equation is balanced.

Answer: Zn + 2 HC2H3O2 → Zn(C2H3O2)2 + H2

Answer:

c. plastic is an insulator

Explanation:

a and b are metals which are conductors and d contains water which is also a conductor

The formula of sodium oxide is Na2O .

Answer:

The answer to this is Na2O

There are thousands of hydrogen atoms so together they can let off or group up to form all four colors.

Hydrogen is a chemical element with the symbol H and atomic number 1. Hydrogen is the lightest element. Under standard conditions, hydrogen is a diatomic molecular gas of the formula H2. It is colorless, odorless, tasteless, non-toxic, and highly flammable.

Hydrogen is an energy carrier that can be used to store, transfer, and deliver energy generated from other energy sources. Hydrogen fuel can be produced today by several processes. The most commonly used methods today are natural gas reforming (a thermal process) and electrolysis. It is found in the Sun and most stars, and the planet Jupiter is composed primarily of hydrogen. On Earth, hydrogen is most abundant as water. As a gas in the atmosphere, it is present in trace amounts, less than 1 ppm by volume.

Learn more about  hydrogen   here

https://brainly.com/question/19813237

#SPJ4

\({ \red{ \underline{ \tt{Langmuir \: adsorption \: isotherm:}}}}\)

The defect of Freundlich adsorption isotherm is that it fails at high pressure of the gas.

Langmuir derived the adsorption isotherm based on the theoretical considerations. It is generally applied to chemical adsorption.

It can be expressed as

\({ \blue{ \bold{ \frac{X}{m} = \frac{AP}{1+BP}}}}\)

where,

X = mass of the gas adsorbed

M = mass of the adsorbent

P = equilibrium pressure

Answer:

the equation is balanced

The answer is 0.365:100.

v/c ratio represents ratio of speed of an electron (v) to the speed of light (c).

How is the speed of an electron calculated?

\(v =\frac{1}{n}\; \frac{e^{2}}{4\pi \varepsilon _{0}}\times \frac{2\pi }{h}\)

Now, for the first excited state, n = 2.

e - Charge of electron = \(1.6\)×\(10^{-19}\) C

h - Plank's constant = \(6.6\)×\(10^{-34} J.s\)

ε₀- permittivity \(= 8.85\)×\(10^{-12}\)\(N^{-1}.C^{2}.m^{-2}\)

\(v =\frac{1}{2}\; \frac{e^{2}}{4\pi \varepsilon _{0}}\times \frac{2\pi }{h} =\frac{1}{4}\times \frac{(1.6\times 10^{-19})^{2}}{8.85\times 10^{-12}\times 6.6\times 10^{-34}}\\ \\ =0.01096\times 10^{8} \\ \\=1.096\times 10^{6}ms^{-1}\)

\(\frac{v}{c} =\frac{1.096* 10^{6}\ m/s }{3.0 *10^{8}\ m/s }\)= \(\frac{0.365}{100}\)

To learn more about the speed of an electron (v), visit:

https://brainly.com/question/13198566

#SPJ4

To select four species that can be identified as molecules from the given list, you should look for species that are composed of two or more atoms chemically bonded together. The correct options are:

1. CO (Carbon monoxide) - A molecule consisting of one carbon atom and one oxygen atom bonded together.
2. CO2 (Carbon dioxide) - A molecule consisting of one carbon atom and two oxygen atoms bonded together.
3. O2 (Oxygen) - A diatomic molecule consisting of two oxygen atoms bonded together.
4. CH3OH (Methanol) - A molecule consisting of one carbon, four hydrogen, and one oxygen atom bonded together.

Your answer: Four species that can be identified as molecules from the list are CO, CO2, O2, and CH3OH.

To know more about Carbon monoxide:

https://brainly.com/question/10193078

#SPJ11

Answer:

(9.03x10^-14)x(8.455x10^20)=7.634865x10^7

(5.2x10^11)/(2.10x10^-4)=2.476190x10^15

(7.67x10^12)x(3.8x10^15)=29146000000000000000000000000

(9.237x10^20)/(4.5x10^-6)=2.0526x10^26

Explanation:

Low pressures and high temperatures are the optimal conditions for gas behaviour. The ideal gas law \(PV = nRT\) states that ideal gases must conform to this law.

It is only feasible if the gas is made up of several freely moving point particles that do not interact with each other and have a very small total volume. An ideal gas is one in which all collisions between atoms or molecules are completely elastic and in which there are no intermolecular attraction forces. It can be compared to a collection of perfectly hard spheres that collide but do not interact with one another in any other way. The molecules of perfect gases are not attracted to one another or repel one another.

Learn more about Ideal gas here:

https://brainly.com/question/27870704

#SPJ4

Answer:

They then put a balloon on top of the bottle immediately after adding them together. The student observed that the balloon inflated and got larger.

Explanation:

Btw brainliest me plss

Answer:

The student's prediction is wrong.  Mass cannot be spontaneously created.

Explanation:

Sorry, but all the other answers are wrong. They didn't even come close to answering your question. This question concerns ourselves with the law of mass conservation. This states that, in a reaction, the total mass of the reactants must equal the total mass of products formed after the reaction. For instance, if the mass of the reactants both weighed 5 grams, then the products, if you measured their weight afterwards, would be 5 grams. The reaction does not generate new mass at the end of the reaction, this cannot be done for any reaction, let alone this one. Thank you!

The common intermolecular forces involved between dye molecules and fabric fibers include dipole-dipole interactions, London forces, and hydrogen bonding.

The fibers that are mentioned in the test fabric are bamboo, wool, linen, cotton, nitrile, silk, polyester, Tencel, acetate, nylon, rayon, and acrylic. However, it is not specified which fibers are being analyzed for the intermolecular forces.

Intermolecular forces are the forces of attraction or repulsion that occur between molecules. These forces determine many of the physical properties of materials, including their melting and boiling points, viscosity, and solubility. When dyes are applied to fabric, the intermolecular forces between the dye molecules and the fabric fibers play a critical role in determining how well the dye adheres to the fibers and how well it resists fading.

Learn more about intermolecular forces here:

https://brainly.com/question/17111432

#SPJ4

It takes approximately 100.704 years (since 1964) until only 9 percent of the original amount of radioactive strontium-90 absorbed remains.

The half-life of radioactive strontium-90 is given as 29 years, which means that every 29 years, the amount of radioactive strontium-90 is reduced by half.

To find the number of years it takes until only 9 percent of the original amount remains, we can set up the following equation:

(0.5)^(t/h) = 0.09

Where:

t represents the number of years since 1964 (the initial time),

h represents the half-life of 29 years, and

0.09 represents 9 percent.

Let's solve for t:

(0.5)^(t/29) = 0.09

Taking the natural logarithm (ln) of both sides:

ln[(0.5)^(t/29)] = ln(0.09)

Using the logarithmic property: ln(a^b) = b × ln(a):

(t/29) × ln(0.5) = ln(0.09)

Dividing both sides by ln(0.5):

t/29 = ln(0.09) / ln(0.5)

t = 29 × (ln(0.09) / ln(0.5))

Using a calculator, we can find the value of t:

t = 29 × (-2.40794561 / -0.69314718)

t = 100.704

Learn more about radioactive -

brainly.com/question/23759636

#SPJ11

Answer:

- From octane: \(m_{CO_2}=1.54x10^5gCO_2\)

- From ethanol: \(m_{CO_2}=9.57x10^4gCO_2\)

Explanation:

Hello,

At first, for the combustion of octane, the following chemical reaction is carried out:

\(C_8H_{18}+\frac{25}{2} O_2\rightarrow 8CO_2+9H_2O\)

Thus, the produced mass of carbon dioxide is:

\(m_{CO_2}=5.00x10^4gC_8H_{18}*\frac{1molC_8H_{18}}{114gC_8H_{18}}*\frac{8molCO_2}{1molC_8H_{18}}*\frac{44gCO_2}{1molCO_2} \\\\m_{CO_2}=1.54x10^5gCO_2\)

Now, for ethanol:

\(C_2H_6O+3O_2\rightarrow 2CO_2+3H_2O\)

\(m_{CO_2}=5.00x10^4gC_2H_6O*\frac{1molC_2H_6O}{46gC_2H_6O}*\frac{2molCO_2}{1molC_2H_6O}*\frac{44gCO_2}{1molCO_2} \\\\m_{CO_2}=9.57x10^4gCO_2\)

Best regards.

GGCCATAGGTCCCTTTAGCG

I believe this is correct (I used the complementary base)

This problem is providing a mathematical expression which the result should be expressed with the correct significant figures. At the end, the result is 1209.0 because of the following:

In science, the use of significant figures is crucial as long numbers are not necessarily required when reporting a numerical value, for that reason the importance of reporting measurements with the correct number of significant figures.

In the case of additions, we perform the normal operation as the first step:

1204.2 +4.79613 = 1208.99613

Next, we round the result to the least number of decimal places, in this case one because 1204.2 has just one decimal place, unlike the 4.79613 which has five, so that we round the 8 up to 9 and leave a 0 as the only decimal place:

1209.0

Learn more about significant figures: https://brainly.com/question/11904364

Answer:

13.6 g

Explanation:

The mass of BeF₂ present in 655 ml of a solution that is 0.442 M is equal to 13.82 g.

We can calculate the concentration of a solute in a solution in terms of molarity, molality, and normality.

The molarity of a particular solution can be determined from the number of moles of a solute per unit volume of the solution.

The Molarity of the particular solution can be determined from the mathematical formula mentioned below:

Molarity = Moles/Volume of the Solution

Given, the molarity of BeF₂ solution = 0.442 M

The volume of the BeF₂ solution, V = 655 ml = 0.655 L

The molar mass of the BeF₂, M = 47.01 g/mol

Molarity of BeF₂ solution = m/(M × V)

0.442 = m/ (47.01 × 0.655)

m = 13.82 g

Therefore, 13.82 g of BeF₂ is required for the given solution.

Learn more about molarity, here:

brainly.com/question/8732513

#SPJ2

Explanation:

Corrosion of iron is called as rusting. Rusting is oxidation of iron in the presence of oxygen and water and leads to formation of hydrated ferric oxide.

Methods to prevent rusting are :

1. Application of paint: It prevents the direct exposure of metal to atmosphere.

2. Application of oils or grease: It creates a barrier between the metal and atmosphere.

3. Galvanization : It is coating of iron with more active metal zinc so that zinc gets oxidized and protects iron.

4. Cathodic protection : It involves connecting iron to a more active metal which loses electrons on behalf of iron and thus protects iron by rendering it as cathode.

5. Coating with wax tapes: It prevents the direct exposure of metal to atmosphere.

In a compression, the particles in the air are arranged closer together than in a normal state, resulting in an increase in air pressure.

In a rarefaction, the particles in the air are arranged further apart than in a normal state, resulting in a decrease in air pressure.

What is compression?

The increase in pressure is due to the collisions between the particles becoming more frequent, which leads to an increase in the number of particles in a given volume. This can occur due to the presence of a sound wave, for example, which causes alternating regions of high and low pressure in the air.

What is rarefaction?

This occurs because the particles are moving farther away from each other due to a decrease in the number of collisions between them. This can also occur due to the presence of a sound wave, where the alternating regions of high and low pressure cause the particles to move back and forth, resulting in areas where the particles are further apart than usual.

To know more about particles, visit:

https://brainly.com/question/11254035

#SPJ1

Complete question is: In a compression, the particles in the air are arranged closer together than in a normal state, resulting in an increase in air pressure and In a rarefaction, the particles in the air are arranged further apart than in a normal state, resulting in a decrease in air pressure.

Answer:

A. PO4^3-

Explanation:

took the quiz on a pex

The conjugate base of HPO₄²⁻ is PO₄³⁻. Therefore, option (A) is correct.

The Bronsted-Lowry concept can be explained as an acid-base reaction where base and acid react with each other and by an exchange of proton acid, forms its conjugate base and the base generates its conjugate acid.

The Bronsted-Lowry theory is an extended version of Arrhenius's theory of acid-base. According to this concept, acid can be defined as a substance that donates a hydrogen ion or a proton and produces its conjugate base and the base can be defined as a substance that accepts a proton and creates its conjugate acid.

Bronsted-Lowry acid in the dissociation form can be represented as:

Acid   ⇄   Conjugate base +   H⁺

The conjugate base of Bronsted-Lowry acid HPO₄²⁻ can be represented as follows:

HPO₄²⁻   ⇄  PO₄³⁻ +   H⁺

Therefore, PO₄³⁻ is the conjugate base of the Bronsted-Lowry acid HPO₄²⁻​.

Learn more about the Bronsted-Lowry concept, here:

brainly.com/question/14407412

#SPJ2

Answer:

Their isn't your examples but I will give you mine

Freezing, Evaporation and so on.

A very reactive metal is image D

A reactive metal is a metal that readily reacts with other substances in its environment, particularly with non-metals such as oxygen, chlorine, sulfur, and nitrogen. The reactivity of a metal depends on the ease with which it can lose electrons to form positive ions.  These metals are often used in chemical reactions because of their reactivity

The metal that has been shown in the image that is attached in option D is sodium which is known to loose electron easily hence it is a reactive metal.

Learn more about reactive metal:https://brainly.com/question/20570629

#SPJ1

Answer:

Hrishikesh. bshjsjbd. jwjjja

According to the concept of solubility,  pouring water in isopropyl will sink salt water will mix and vegetable oil will  rise to the top.

Solubility is defined as the ability of a substance which is basically solute to form a solution with another substance. There is an extent to which a substance is soluble in a particular solvent. This is generally measured as the concentration of a solute present in a saturated solution.

The solubility mainly depends on the composition of solute and solvent ,its pH and presence of other dissolved substance such as salts.

Learn more about solubility,here:

https://brainly.com/question/31493083

#SPJ1

Answer:

Comrades it's B

Explanation:

You can trust me or not but it will be your fauit if you fail so i say trust me comrade. Glroy to Alpha!

A molecule's shape greatly influences the polarity of the compound, the molecular structure has an impact on molecular characteristics. The shape of a molecule affect the molecule's function. Therefore, option B is correct.

Based on the environment, the term may or may not include ions that meet this requirement. A molecule is a collection of two or more atoms held together by the attractive forces known as chemical bonds.

Molecule shape play a key role in anticipating how one molecule may interact with another, as well as in determining macroscopic features like melting and boiling points.

Polar substances have higher boiling and melting temperatures, tend to dissolve in other polar compounds, and can either form solids or liquids.

Thus, option B is correct.

To learn more about the molecule, follow the link;

https://brainly.com/question/19556990

#SPJ5

Oxidation D) occurs when the electrons are lost from an atom or compound. Oxidation refers to a chemical reaction where there is a transfer of electrons from one substance to another.

During oxidation, the substance that loses electrons is known as the reducing agent while the substance that gains electrons is known as the oxidizing agent. When an atom or compound loses electrons during oxidation, it becomes more positively charged, and this results in a decrease in its negative charge.

For example, when iron rusts, it undergoes oxidation as it loses electrons to oxygen. The iron atoms lose their electrons, and as a result, they become positively charged. This causes the iron compound to have a more positive charge than it did before the oxidation process.

In summary, oxidation occurs when electrons are lost from an atom or compound, which results in a decrease in the negative charge of the compound or atom.

Learn more about oxidizing agent here:

brainly.com/question/10547418

#SPJ11

Answer:

a.) exothermic

b.) 2,800.6 J

Explanation:

Answer:

30

Explanation:

im smart

Answer:

The longest duration between full moon to new moon (or new moon to full moon) lasts about 15 days and 14.5 hours, while the shortest duration between full moon to new moon (or new moon to full moon) lasts only about 13 days and 22.5 hours. New Moon appears higher on summer solstice than on winter solstice.