The reaction between a carboxylic acid and an amine yields is a(n)
a. aldehyde
b. amide
c. ester
d. ketone

Answers

Answer 1

The reaction between a carboxylic acid and an amine yields an amide. Among the given options, the correct choice is (b) amide.

When a carboxylic acid reacts with an amine, a condensation reaction called amidation occurs. During this reaction, the carboxylic acid functional group (-COOH) reacts with the amine functional group (-NH2) to form an amide (-CONH2). The reaction involves the removal of a water molecule (H2O) and the formation of a new bond between the carbonyl carbon of the carboxylic acid and the nitrogen of the amine.

The reaction can be represented as follows:

Carboxylic acid + Amine → Amide + Water

Therefore, the correct answer is (b) amide.

Learn more about amides here: brainly.com/question/32186558

#SPJ11

Answer 2

The reaction between a carboxylic acid and an amine yields is: b. amide.

When a carboxylic acid reacts with an amine, it forms an amide. The reaction is known as an amide formation reaction. In this reaction, the carboxylic acid donates a proton (H⁺) from the carboxylic acid group (-COOH), and the amine donates a pair of electrons to form a new bond. The resulting compound is an amide, which has the general structure RCONH₂, where R represents an organic group.

The formation of an amide involves the condensation of a carboxylic acid and an amine, resulting in the loss of a water molecule. The reaction is commonly known as an amide condensation or amidation reaction.

Options a, c, and d (aldehyde, ester, and ketone) are not formed directly from the reaction between a carboxylic acid and an amine. Aldehydes and ketones are formed through other types of reactions such as oxidation of alcohols or cleavage of diols. Esters are formed through the reaction between a carboxylic acid and an alcohol, not an amine. Thus, the correct answer is b. amide.

learn more about Amide here:

https://brainly.com/question/29595493

#SPJ4


Related Questions

how much energy is needed to convert 120g of ice at -35°C to steam at 150°C?

Answers

381,840 J would be the answer

titanium(iv) oxide, tio subscript 2 is brilliantly white and much of the oxide produced is used in the manufacture of paint. what is the maximum amount of tio subscript 2 obtainable from 19.0 tonnes of the ore ilmenite, fetio subscript 3? 10.0 tonnes b 12.7 tonnes c 14.0 tonnes d 17.7 tonnes

Answers

10.0 tonnes of TiO₂ can be produced at most from 19.0 tonnes of the mineral ilmenite, FeTiO₃. The first option is correct.

Utilizing the "mole concept," we may determine the mass of chemical substances according to the situation. A mole is a precise unit of measurement for the number of atoms or molecules in a large sample of the substance. It is the amount of a substance that includes precisely the Avogadro number of the substance's "elementary entities". It is practical to express the quantity of a substance using the mole concept.

For the given situation, first, write the complete equation,

\(\mathrm{FeTiO_3\longrightarrow FeO+TiO_2}\)

Then, the mole concept is introduced as,

\(\begin{aligned}\mathrm{\frac{mole\;of\;TiO_2}{mole\;of\;FeTiO_3}}&=\frac{1}{1}\\\mathrm{mole\;of\;TiO_2}&=\mathrm{mole\;of\;FeTiO_3}\\\mathrm{\frac{m_{TiO_2}}{79.9}}&=\frac{19.0}{151.7}\\\mathrm{m_{TiO_2}}&=\frac{79.9\times19.0}{151.7}\\&=\mathrm{10.00\;tonnes}\end{aligned}\)

The required answer is 10.0 tonnes.

To know more about mole:

https://brainly.com/question/15209553

#SPJ4

Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
HELP ME PLEASEEEEE !!

Answers

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

Use the following, balanced equation for the question below:
2Al(s) + 3CuCl₂(aq) → 3Cu(s) + 2AlCl3(aq)
How many moles of aluminum are needed to produce 50.0 grams of aluminum chloride?

Answers

Answer:

0.375 moles Al

Explanation:

To find the moles Al, you need to (1) convert grams AlCl₃ to moles AlCl₃ (via molar mass) and then (2) convert moles AlCl₃ to moles Al (via mole-to-mole ratio from equation coefficients). It is important to arrange the ratios/conversions in a way that allows for the cancellation of units. The final answer should have 3 sig figs to match the sig figs of the given value (50.0 g).

Molar Mass (AlCl₃): 26.982 g/mol + 3(35.453 g/mol)

Molar Mass (AlCl): 133.341 g/mol

2 Al(s) + 3 CuCl₂(aq) -----> 3 Cu(s) + 2 AlCl₃(aq)

50.0 g AlCl₃           1 mole                 2 moles Al
--------------------  x  ------------------  x  -----------------------  =  0.375 moles Al
                               133.341 g           2 moles AlCl₃

Plz help
I don't know chem that well

Plz helpI don't know chem that well

Answers

Have a periodic table out! Group # are the ones on the top, # of protons is the atomic #, valence electrons corresponds with the ones digit on the group #, and oxidation # is the charge of the atom (positive on the left half, negative on the right half of the PT), then you just put the element and add the oxidation #!
To find these answers you can just pull up the picture of the periodic table. The # of protons can be found at the top of the element, AKA, the atomic number. The group number is which column the element is in, there are 18 groups, counting from left to right. The valence electrons and oxidation are found similarly by which column they are in, each column is different so I would advise looking it up for each element. And lastly, the Ion that will form is found by finding the ionic charge of each element. I hope this helps. :)

Please answer before 10:30 tomorrow.

Unusually cold winters are problematic for Florida manatees. Colder air temperatures lead to colder water, which can lead to manatee illness and death. Fortunately, manatees can take shelter in warmer waters near natural springs and power plants. Which of the following accurately describes this chain of events leading to manatee illness?

A . Changes in the atmosphere causes changes to the hydrosphere, which effects the biosphere

B. Changes in the atmosphere affect the cryosphere which, affects the hydrosphere

C. Changes in the hydrosphere causes changes to the biosphere, which affect the atmosphere.

D. Changes in the geosphere cause changes
to the hydrosphere; which affects the atmosphere

Answers

All the levels of atmosphere and biospheres are interconnected. The changes in each level would cause a change in the other. Here, the atmospheric changes causes changes in hydrosphere which then affects the biosphere. Thus option A is correct.

What is biosphere ?

Biosphere is the level or region in earth where all living things exists. There are different types of biospheres also called as ecosystems. They are mainly forests, aquatic systems, grasslands, deserts, marshy lands etc.

All these ecosystems are related with the surrounding atmosphere and hydrosphere. There may happen certain atmospheric changes such as in the overall temperature, humidity, cold, air quality etc depends on the composition of gases and dusts.

Any change in atmosphere such as fall in temperature make a change in hydrosphere and thus affects the water used by the livings in biosphere. Hence the change starts from the atmosphere causes a change in hydrosphere then affect the  biosphere. Thus option A is correct.

To find more about biospheres, refer the link below:

https://brainly.com/question/13219657

#SPJ1

using equation explain what happens when hydrogen peroxide is added to lead​

Answers

The reaction equation is PbS+4H2O2→PbSO4+4H2O

What is the reaction of lead sulfide and hydrogen peroxide?

This is a redox reaction where the hydrogen peroxide (H2O2) acts as an oxidizing agent, and the lead sulfide (PbS) is oxidized to form lead sulfate (PbSO4). The hydrogen peroxide is reduced to form water (H2O). The reaction produces a white precipitate of lead sulfate, which is insoluble in water and can be easily separated from the reaction mixture.

It is worth noting that the reaction between lead sulfide and hydrogen peroxide may not occur spontaneously, and a catalyst may be needed to initiate the reaction.

Learn more about reaction:https://brainly.com/question/28984750

#SPJ1

Missing parts;

using equation explain what happens when hydrogen peroxide is added to lead​ sulfide

what is a mixture of elements and compounds

what is a mixture of elements and compounds

Answers

The substance in the image above would be classified as a mixture of elements (option E).

What is a compound and mixture?

A compound is a substance formed by chemical bonding of two or more elements in definite proportions by weight.

On the other hand, a mixture is made when two or more substances are combined, but they are not combined chemically.

According to this question, an image is shown with two different substances or elements as distinguished by coloration (white and purple). These elements are combined but not chemically bonded, hence, is a mixture.

Learn more about mixture at: https://brainly.com/question/12160179

#SPJ1

The internal combustion engine takes advantage of the ability of the combustion reaction of gasoline to do _______ and move a piston up and down.
A. free energy
B. enthalpy
C. work
D. entropy
PLS HELP ASAP THANK YOU!!!

Answers

The answer is C, work. The reaction of the air/gas mixture being ignited produces energy which moves the piston up and down which turns the crankshaft.

what form can a toxic substance take

Answers

The Toxic materials can be take the form of the solids, the liquids, the gases, the vapors, the dusts, the fumes.

The Toxic materials can be take the form of the solids, the liquids, the gases, the vapors, the dusts, the fumes, the fibers and the mists. The Toxic substances are the substance that can be defined as the broad group of the chemicals that are capable of the causing harm to the plants and the animals including the humans.

The  toxic substance is the substance that can be harmful or even the poisonous to the health. The People are mostly concerned about the as the chemicals like polychlorinated biphenyls.

To learn more about toxic here

https://brainly.com/question/7637675

#SPJ4

Carbon dioxide is a greenhouse gas, if atmospheric concentrations increased rapidly what is a possible outcome?.

Answers

If atmospheric concentration of CO2 is increased it can increase the temperature of the Earth and leads to global warming.

What are greenhouse gases?

A greenhouse gas (GHG or GhG) is a gas that produces the greenhouse effect via absorption and emission of radiant energy in the thermal infrared range. Water vapor (H2O), carbon dioxide (CO2), methane (CH4), nitrous oxide (N2O), and ozone are the main greenhouse gases in the atmosphere of the Earth (O3). Without greenhouse gases, the surface of the Earth would typically be roughly 18 °C (0 °F) instead of the current average of 15 °C (59 °F). In addition, greenhouse gases are present in the atmospheres of Venus, Mars, and Titan.

As a result of human activity, especially the burning of fossil fuels, which raises the levels of heat-trapping greenhouse gases in Earth's atmosphere, the surface of the planet has been warming over time, as seen since the pre-industrial era (between 1850 and 1900). The terms "climate change" and this one are not synonymous.

Hence, if atmospheric concentration of CO2 is increased it can increase the temperature of the Earth and leads to global warming.

To know more about green house gases from the given link

https://brainly.com/question/20349818

#SPJ4


In an electron configuration ,what does the s in 1s2 represent?

Answers

Answer:

The superscript after the letter

tells us the electrons are in the n=2 energy level.

Explanation:

HELP DUE IN 5MIN WILL MARK BRAILIEST

pLS ANSWER THIS QUESTION THE QUESTION IN THE SCREEN SHOT HAVING TO DO WITH ICE AND WATER

HELP DUE IN 5MIN WILL MARK BRAILIESTpLS ANSWER THIS QUESTION THE QUESTION IN THE SCREEN SHOT HAVING TO

Answers

Explanation:

The problem deals with a phase transition from solid to liquid. To the left we have ice and to the right we have liquid water.

For such change to take place, the process of melting must occur. During melting, a solid changes state from solid to liquid by taking energy from the environment.

In solid state, the molecules of the water are in a fixed state about their fixed lattice. As the solid ice gains energy from the environment, it begins to melt. Energy increase causes the molecules of the water to start flowing to form a liquid.

_______ collect the light from distant stars and separate that light into bands of different colors. This allows astronomers identify the elements in a star and analyze how they are moving.
A) spectroscopes B) Visible light telescope C) Optical telescope D) space probes

Answers

The answer to your question is A.

Answer:

A) Spectroscopes

Explanation:

Spectroscopes collects the light from distant stars and separate that light into bands of different colors; by studying these bands, astronomers identify the elements in a star.

Will the volume of a gas increase, decrease, or remain unchanged for each of the following sets of changes?
(a) The pressure is decreased from 2 atm to 1 atm, while the temperature is decreased from 200°C to 100°C.

Answers

The answer would be 150 half of 200 and 100 is 150

Silver is composed of a single type of atom and cannot be broken down into different substances. Silver is an example of a(n)
ОА.
element
ОВ.
compound
molecule

Answers

I think it could be A. Element

A lagoon waste pit has the following historical data for the barium concentration based on a simple random sampling (n = 4): 86, 90, 98, 104 mg/kg (the lower two thirds of lagoon). The regulatory threshold for barium is 100 mg/kg. The waste on this site was categorized to be hazardous, and therefore a more thorough sampling plan is needed. Determine the number of samples required so that the reported mean has a 90 % confidence level.

Answers

the number of samples required so that the reported mean has a 90% confidence level is 72.

A lagoon waste pit has the following historical data for the barium concentration based on a simple random sampling (n = 4): 86, 90, 98, 104 mg/kg (the lower two thirds of lagoon). The regulatory threshold for barium is 100 mg/kg. The waste on this site was categorized to be hazardous, and therefore a more thorough sampling plan is needed. We have to determine the number of samples required so that the reported mean has a 90% confidence level.

To determine the number of samples required so that the reported mean has a 90% confidence level, we need to use the formula for the sample size.

n = [(z^2 * σ^2)/E^2]

Where n is the sample size, z is the standard normal value for the desired level of confidence, σ is the standard deviation, and E is the maximum error of estimate that is allowed.

Given,The lower two-thirds of the lagoon contains 86, 90, 98, 104 mg/kg barium concentration

The standard deviation is given by the formula as follows:

σ = √[(∑(x - μ)^2)/n]

where σ is the standard deviation, x is the individual data points, μ is the mean, and n is the sample size.

μ = [(86 + 90 + 98 + 104)/4]

= 94σ = √[((86 - 94)^2 + (90 - 94)^2 + (98 - 94)^2 + (104 - 94)^2)/4]

= 6.46E

is the maximum error of estimate that is allowed which is 2 mg/kg (100-98)z for a 90% confidence level is 1.645Putting all the values in the formula, we get;

n = [(z^2 * σ^2)/E^2]= [(1.645^2 * 6.46^2)/2^2]

= 71.8Since we cannot have 0.8 of a sample, we need to round the answer up, the required number of samples is 72.

Thus, the number of samples required so that the reported mean has a 90% confidence level is 72.

learn more about standard deviation here

https://brainly.com/question/475676

#SPJ11

select the statements that correctly describe an object in thermal equilibrium with a reservoir.

Answers

The object and the reservoir have the same temperature: In thermal equilibrium, the temperature of the object and the temperature of the reservoir are equal. There is no net heat transfer occurring between the two.

There is no change in temperature over time: In thermal equilibrium, the temperature of the object remains constant over time. There is no net flow of heat between the object and the reservoir.The object and the reservoir are in thermal contact: For thermal equilibrium to be achieved, the object and the reservoir must be in direct or indirect thermal contact. This allows for the transfer of thermal energy between them until their temperatures equalize.

To know more about energy visit :

https://brainly.com/question/8630757

#SPJ11

One way to slow down global climate change is to
А
use less nonrenewable resources.
B
use more nonrenewable resources.
с
drive cars that only burn fossil fuels.
D
use less dangerous ways to find oil.

Answers

A
Because it will slow down global climate change

One way to slow down the global climate change is to reduce the use of nonrenewable sources such as fossil fuels because, they release harmful gases that  leads to global warming.

What is global warming?

The increase in the overall atmospheric temperature is called global warming. Global warming is mainly caused by green house gases such as carbon dioxide, methane, oxides of nitrogen etc.

Green house gases intensely absorbs heat energy that radiates out from earth. Thus they trap the temperature in the atmosphere make the planet warmer.

Nonrenewable energy sources such as nuclear reactions, fossil fuels, coal etc. coal and petroleum are highly rich in toxic gases and burning them releases these gases including carbon dioxide and methane to the atmosphere increase the rate of global warming.

Therefore, reducing the use of nonrenewable resources is a good way to slow down the global climate change.

Find more on global warming:

https://brainly.com/question/29625243

#SPJ2

What is the electron configuration for manganese

Answers

Electron configuration for manganese is [Ar]3d⁵4s² and electron configuration is the distribution of electrons of an atom or molecule

The electronic configuration of an element is a symbolic notation of the manner in which the electrons of its atoms are distributed over different atomic orbitals and atomic number of manganese is 25 then electronic configuration [Ar]3d⁵4s² manganese is a chemical element with the symbol Mn and it is a hard, brittle, silvery metal, often found in minerals in combination with iron and atomic mass is 55.93 and we write electronic configuration is 1s²2s²2p⁶3s²3p⁶4s²4d⁵ called as electronic configuration of  manganese

Know more about electron configuration

https://brainly.com/question/15489236

#SPJ1

If a metal had a D = 12.66 g/ml, what is the volume of 1.266 g?

Answers

Answer:

DENSITY

Density is defined as mass per unit volume.

d =  

m

V

Example:

A brick of salt measuring 10.0 cm x 10.0 cm x 2.00 cm has a mass of 433 g. What is its density?

Step 1: Calculate the volume

V = lwh = 10.0 cm × 10.0 cm × 2.00 cm = 200 cm³

Step 2: Calculate the density

d =  m V  =  433 g 200 c m ³  = 2.16 g/cm³

MASS

d =  m V

We can rearrange this to get the expression for the mass.

m = d×V

Example: If 500 mL of a liquid has a density of 1.11 g/mL, what is its mass?

m = d×V = 500 mL ×  

1.11

g

1

m

L

= 555 g

VOLUME

d =  

m

V

We can rearrange this to get the expression for the volume.

V =  

m

d

Example:

What is the volume of a bar of gold that has a mass of 14.83 kg. The density of gold is 19.32 g/cm³.

Step 1: Convert kilograms to grams.

14.83 kg ×  

1000

g

1

k

g

= 14 830 g

Step 2: Calculate the volume.

V =  

m

d

= 14 830 g ×  

1

c

m

³

19.32

g

= 767.6 cm³

Explanation:

Which element tends not to react with other elements?

A

xenon

B

hydrogen

C

phosphorous

D

potassium

Answers

Answer:

I believe the answer is Xenon since it is a noble gas

Answer:

I think the answer is A

Explanation:

If im wrong the answer is C

The volume of a gas was 48 mL when the temperature was 159.6 ºC. If the temperature was initially 4.9 ºC, and there was no change in the pressure, what was the initial volume of the gas?

Answers

V1=48mLT1=159.6°CT2=4.9°CV2=?

According to Charles law

\(\boxed{\sf \dfrac{V_1}{T_1}=\dfrac{V_2}{T_2}}\)

\(\\ \sf\longmapsto \dfrac{48}{159.6}=\dfrac{V_2}{4.9}\)

\(\\ \sf\longmapsto V_2=\dfrac{48\times 4.9}{159.6}\)

\(\\ \sf\longmapsto V_2=\dfrac{235.2}{159.6}\)

\(\\ \sf\longmapsto V_2=1.4mL\)

A gaseous product of a reaction is collected at 280K and 0.95 atm. Given
R= 0.0821L⋅atm/mol⋅K , what is the molar mass of the gas, in grams per mole, if 3.25 g of gas occupies 2.56 L?

Answers

The molar mass of the gas, given that 3.25 g of the gas occupied 2.56 L is 30.66g/mol

How do I determine the molar mass of the gas?

To obtain the molar mass of the gas, we shall first obtain the number of mole of the gas. This can be obtained as follow:

Temperature (T) = 280 KPressure (P) = 0.95 atmVolume (V) = 2.56 L Gas constant (R) = 0.0821 atm.L/Kmol Number of mole (n) =?

PV = nRT

0.95 × 2.56 = n × 0.0821 × 280

Divide both sides by (0.0821 × 280)

n = (0.95 × 2.56) / (0.0821 × 280)

n = 0.106 mole

Haven obtain the mole of the gas, we shall determine the molar mass of the gas as follow:

Mole of gas = 0.106 moleMass of gas = 3.25 gMolar mass of gas =?

Molar mass = mass / mole

Molar mass of gas = 3.25 / 0.106

Molar mass of gas = 30.66g/mol

Thus, the molar mass of the gas is 30.66g/mol

Learn more about molar mass:

https://brainly.com/question/15874532

#SPJ1

Explain how the chromatogram shows that all three samples have at least one substance in common.

Answers

Answer:

The chromatogram shows that all three samples have at least one substance in common is described below in detailed explanation.

Explanation:

Chromatography is a process of distributing compounds by applying a changing solution on pure paper. A droplet of the compound solvent is recognized near one edge of the paper and then drained. The edge of the paper, closest to the point, is then drawn into the solution without submerging the place itself.

To get the most reliable temperature measurment, a thermometer should be placed ?

Answers

A thermometer should always be submerged in a substance just deep enough to completely cover the bulb in order to measure temperatures accurately.

What is thermometer?

An instrument known as a thermometer is used to measure temperature or a temperature gradient. A thermometer consists of two key components: a temperature sensor that changes in response to changes in temperature and a way to translate these changes into a numerical value.

An instrument that measures temperature is a thermometer. It is able to gauge the temperature of solids like food, liquids like water, and gases like air.

to learn more about thermometer go to -

https://brainly.com/question/2339046

#SPJ4

Which of the following 0.150 m solutions has the
greatest boiling-point elevation?
Mg(NO3)2
NaNO3
C2H4(OH)2

Answers

The solution with the greatest boiling-point elevation among the given options is Mg(NO₃)₂.

The boiling-point elevation of a solution depends on the concentration of solute particles. In this case, we have three solutions: Mg(NO₃)₂, NaNO₃, and C₂H₄(OH)₂.

Mg(NO₃)₂ dissociates into three ions: Mg²⁺ and two NO₃⁻ ions. NaNO₃ dissociates into two ions: Na⁺ and NO₃⁻. C₂H₄(OH)₂ does not dissociate, so it remains as one molecule.

Since the boiling-point elevation is directly proportional to the number of solute particles, Mg(NO₃)₂, with three ions per formula unit, will have the greatest boiling-point elevation. NaNO₃ has two ions per formula unit, and C₂H₄(OH)₂ has no ionization, resulting in fewer solute particles and lower boiling-point elevation compared to Mg(NO₃)₂.

Learn more about molecule here:

https://brainly.com/question/19922822

#SPJ11

what is the purpose of stirring the seawater solution?

Answers

Mixable liquids can be homogenized and solid particles can be stirred up in liquids by stirring. Stirring effectively balances variations in temperature or concentration.

What impact does stirring have on the rate of solution?

Stirring a solute into a solvent speeds up the rate of dissolution because it spreads the solute's particles out throughout the solvent. For instance, the sugar will dissolve more quickly in iced tea after you add sugar and stir the beverage.

Does stirring aid in salt water dissolution?

It's a frequent misperception that stirring and/or heating are necessary for the dissolving process. This study used quantitative experimental data that was gathered and analyzed to show that dissolving doesn't require heating or stirring.

To know more about Stirring visit:-

https://brainly.com/question/9655111

#SPJ1

Can someone answer the questions in the image?.
“Balancing equations”

Can someone answer the questions in the image?.Balancing equations

Answers

Ans.1

blank 1 =1

blank 2 = 3

blank 3 = 2

Ans.2

blank 1 = 6

blank 2 = 4

blank 3 = 5

Ans.

blank 1 = 11

blank 2 =  7

blank 3 = 8

PLEASE HELP
The actual yield of a product in a reaction was measured as 4.20 g. If the theoretical yield of the product for the reaction is 4.88 g, what is the percentage yield of the product?

82.6%
84.2%
86.1%
88.0%

Answers

Answer: 86.1

Explanation: because i did this in 7th grade

Other Questions
A cruise ship compartment can hold 440 pieces of luggage. If a ship had 42 compartments,how many pieces of luggage can it hold? choose the pair of words or phrases that best completes the sentence below. isoelectronic species have radii that vary with even though they have the same number of . select the correct answer below: the number of electrons; protons atomic number; electrons atomic number; neutrons the number of electrons; neutrons FILL IN THE BLANK complete the sentence below by typing the correct response into the box. the language of informal speech is called________ Which of the following BEST describes the action(s) of the latissimus dorsi?a. Adduction of the humerus ONLYb. Extension of the humerus ONLYc. Flexion of the humerus ONLYd. Flexion and extension of the humeruse. Adduction, extension and medial rotation of the humerus a good way to clarify statistical trends is to 1. increase your speaking rate when giving statistics. 2. consult the Guinness Book of World Records. 3. use exact numbers rather than rounding off. 4. use visual aids when presenting statistics. The risk of a portfolio of stocks depends on the followingfactors, except:a. Risk of the individual stockb. Systematic riskc. Portfolio weightsd. Correlation between t Suppose we want to minimize the function f (x) = 5x+Qx +c"x + 13 where I and e are given by Q = then a = and c = + -9 10 - 15 2 point satisfying the first-order necessary conditions for a solution is O a. (5,6) O b.(10,-9) Oc(-9,10) O d. (6,5) A charge, q1 = +4. 00 MC, is at the origin, and a second charge, 92 =-6. 00 MC, is on the x-axis 0. 300 m from the origin. Find the electric field at a point "+P" on the y-axis 0. 800 m from the origin. What is the net force on "p" (magnitude and direction) In a 1500 or more word rhetorical analysis essay (typed, double spaced), analyze the use and effect of argument (persuasion/rhetorical strategies and devices) in the "Peter H. Coors-Im the NRA" ad (posted on Canvas). In your essay, address the following through the analysis of rhetorical strategy and appealsintent, audience, and central arguments/claims (sometimes these, as well as the intent, are not presented overtly or openly in the text and are implied and meant to be inferred by the target audience). We have already gone over one ad from the same NRA campaign. So use your experience with that text to inform your analysis of this one.Remember analyze for rhetorical strategies such as the Aristotelian appeals--ethos, pathos logos,. Also consider the specific use of these appeals-- to fear, guilt, freedom, choice, logic, charity, etc Also note the use of fallacies and how they are used to insinuate a logical argument. You should also consider how other rhetorical devices work (like anaphora, loaded diction, mythfrom Barthes--, simile, analogy, etc) Remember to use specific examples from the ad and to support your claims about the persuasive aspects of the ad with complete explanations of how the rhetorical strategies/devices work to persuade.PETER H. COORS: President of the Brewing Division of Aldolph Coors Company, Husband, Father, Hunter, Life Member of the National Rifle Association."Lots of people have asked me why I like to hunt. I just feel something about being in the country. Getting up early when its cold and crisp, sitting in a duck bind watching the orange sun rise over the bulrush, swapping stories and drinking hot coffee. Its like bowling or fishing or dirtbiking for other people. Its part of our heritage and our freedom, And some of the most enjoyable times Ive had with my kids have been in that environment. "But there is constant pressure from people who would like to take away the privilege of owning a gun. Its always been difficult for me to understand why they want to restrict legitimate use of firearms. Its not a social problem. The social problem is the illegitimate use of firearms, which should be taken care of by our courts and legal system."I support the NRA because it is the most effective way for individuals to join together in supporting the rights of legitimate users of firearms. Without those rights, the privilege and enjoyment of the hunting experience might be lost for me and my kids. Wed be missing a lot." Im the NRA(In small print below the image)The NRAs Hunter Services Division offers programs and publications for hunter safety and education, including the comprehensive "Basic Hunters Guide." If you would like more information about our publications or would like to join the NRA write to...(NRA address given) Who is your favorite superhero and why?Survey question Solvency refers to the enterprise's ability to meet its day to daycash needstruefalse 7. Simplify the following complex number, without changing the polar form and leave your answer in polar form (2/3)*(32) 42% (6) [TOTAL: 50] With respect to language evaluation criteria, select all language characteristics that affect readability:a. Restricted aliasingb. Data typesc. Type checkingd. Exception handlinge. Orthogonalityf. Syntax designg. Expressivityh. Support for abstractioni. Simplicity Given a surface x - xyz = 56 and a point P(-4,5,2). (a) Find an equation for the tangent plane to the given surface at P. (b) Find parametric equations of normal line to the surface at P. Given the equation x + 4x + y-2y = 20: (HINT: Type in the equation is the desmos calculator and get the answers from the graph.)What is the radius of the circle?What is the center of the circle? after successfully isolating solid copper in part b of this experiment, bernice is wondering if there are other acids that could be used in place of the acids available in part b of this experiment. which of the following acids could be used instead of the provided acids (h2so4 and h3po4) to isolate solid copper in part b of this experiment? select all that applyo. HBro. HNO3o. H2So. H2CO3 In the Voice Disorders text, what approach did the authors use to organize and classify voice disorders? Name 3 of the 5 categories below. The equation y = 8x represents therelationship between the amount oftime Shanay takes to weave threadinto fabric and the number of rows.How long will it take Shanay to weave72 rows of fabric at this constant rate? Mark's secret project has an initial cash outflow of $39,800 and will produce cash inflows of $18,304, $19,516, and $14,280 for years 1 through 3, respectively. What is the NPV of Mark's project if the discount rate is 15%? Should Mark accept the project? C. 46 - {36 (2 3)-(18-12)}