traditional ecological knowledge and western science the case of the bowhead whale what is science? science is both a set of practices (way of knowing) and the historical accumulation of knowledge (body of knowledge). nearly g

Answers

Answer 1

Science is a method for comprehending the natural world and the corpus of information created by several scientists.

Traditional ecological knowledge provides information about climate change across generations as well as the geography of the area's actual residents. Traditional ecological knowledge emphasizes and places at the center of the information it carries information about the health and interactions of the environment.

Whales are near the top of the food chain and serve as important indicators of the marine environment's overall health. The bowhead whale is classified as "special concern" in Canada. They are currently recovering from years of commercial whaler overexploitation.

Science, also known as Western science, is a body of knowledge that is based on certain laws that have been established by applying the scientific method to phenomena in the world around us.

To learn more about traditional ecological knowledge and western science, here

https://brainly.com/question/15518042

#SPJ4


Related Questions

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Assume that a 100 base pair DNA ladder contains 45 cytosines. How many guanines are there?

Answers

Answer:

45 guanines

Explanation:

In a DNA strand, each nitrogen base only pairs with one other specific base.

Adenine pairs with thymine, and cytosine pairs with guanine.

This means that the amount of adenine is always equal to the amount of thymine, and the amount of cytosine is always equal to the amount of guanine.

So, if the DNA ladder has 45 cytosines, there will be 45 guanines.

Pictured below is an image of a bat (left) and a whale (right). Both creatures use echolocation: the ability to determine the distance of an object or another animal through echoes. Lesser short-nosed fruit bat (Cynopetrus brachyotis) by Anton Croos licensed under CC BY-SA 4.0. Humpback whale with her calf by National Marine Sanctuaries licensed under CC BY 2.0. Explain whether a. these two species evolved by convergent or divergent evolution b. the ability to use echolocation is an analogous or homologous characteristic

Answers

Convergent evolution refers to the phenomenon where different species independently evolve similar traits or characteristics in response to similar environmental conditions or selective pressures. The whale and the bat most likely developed via convergent evolution.

When unrelated creatures spontaneously acquire identical features or adaptations to fit comparable ecological niches or lifestyles, this is known as convergence in evolution. In this instance, echolocation has developed in both the whale and the bat despite coming from distinct evolutionary branches.

An example of a similar trait is the use of echolocation by whales and bats. Similar qualities that have separately developed in other animals yet have analogous functions or goals are referred to as analogous characteristics. In this instance, the capacity to utilise echolocation to navigate and find prey or items in their habitats has independently developed in both bats and whales.

Therefore, the use of echolocation in bats and whales is considered an analogous characteristic.

For more details regarding convergent evolution, visit:

https://brainly.com/question/31115853

#SPJ1

To use the energy in glucose molecules, what must happen to glucose in all living things?

Answers

Answer:the glucose molecule is oxydised in the mitochondria to produce co2 + water+ energy

Explanation:

If it helps mark brainliest

method of improving Sandy soil​

Answers

\(\huge\sf\red{Answer}\)

Methods To improve Sandy Soil:

— Work in 3 to 4 inches of organic matter such as well-rotted manure or finished compost.

— Mulch around your plants with leaves, wood chips, bark, hay or straw.

— Mulch retains moisture and cools the soil.

— Add at least 2 inches of organic matter each year.Grow cover crops or green manures.

Answer:

Soil is easily made out of compost which makess the soil healthy

Explanation:

Help me out I’m stuck here

Help me out Im stuck here

Answers

Answer:

The cells survive best under acidic conditions

Explanation:

To understand this graph, you first need to understand what data is being given. All you are given is cell survival and pH.

With this, the pH has an obvious effect on cell survival. Higher pH (basic environment) correlates to more cells dying. Knowing this, you can rationalize that the more acidic environments with a low pH are the best environment for it.

Also, it would not survive well in distilled water since its pH lies somewhere north of 6, which is shown to not be ideal here.

Stack of membranes that packages chemicals

Answers

Term: golgi apparatus

Definition: stack of membranes that packages chemicals

The stack of membranes that packages chemicals is called the Golgi apparatus.

How do  we explain?

Golgi apparatus. is described as  a complex organelle found in eukaryotic cells. The Golgi apparatus is responsible for packaging and exporting proteins and other molecules from the cell.

The Golgi apparatus is said to be made up of a stack of flattened sacs called cisternae. The cisternae are arranged in a series of concentric layers. The Golgi apparatus is located near the nucleus of the cell.

Learn more about  Golgi apparatus at:

https://brainly.com/question/1768509

#SPJ6

Identify one factor, besides genetics, that could influence the
development of human offspring.

Answers

Answer:

Drugs/alcohol/tobacco

Explanation:

environment

hormones

diseases

Drugs ,alcohol and tobacco could influence the development of human offspring apart from genetics.

How does alcohol and smoking affect fertility?

Alcohol consumption resulted in significant increases in morphologically abnormal nuclei and plasma membranes. Heavy smoking was associated with decreased sperm counts and alcohol consumption was associated with increased numbers of morphologically abnormal sperm.

What are the effects of drugs alcohol and tobacco on an unborn baby?

The effect could be premature birth, low birth weight, miscarriage and cot death. Breathing problems and wheezing in the first six months of life.

To learn more about Drugs ,alcohol and tobacco here

https://brainly.com/question/1867223

#SPJ2

Please place the following (Protein Synthesis) steps in the right order:


Protein Synthesis Steps:

 mRNA carries the newly copied code out of the nucleus and to the ribosome.

 The proteins get to work!

 RNA nucleotides pair up with their corresponding DNA bases, copying the code.

 tRNA brings the appropriate amino acids to the ribosome depending on the code.

 A series of amino acids make up the newly formed proteins.

 DNA unzips exposing nitrogen bases.


(Please answer ASAP) Thank you so much for the ones who have used their time to help me with this, I really appreciate it! Have a great night/day!

Answers

Answer:

Explanation:

1. DNA unzips exposing nitrogen bases

2. RNA nucleotides pair up with their corresponding DNA bases, copying the code

3. mRNA carries the newly copied code out of the nucleus and to the ribosome

4. tRNA brings the appropriate amino acids to the ribosome depending on the code.

5. A series of amino acids make up the newly formed proteins.

6. The proteins get to work!

Which star will most likely have heavier elements such as iron, silicon, oxygen, neon, and carbon in its core?


Question 5 options:


White dwarf



Protostar



Main sequence



Supergiant

Answers

Answer:

Supergiant

Explanation:

supergiants is one of the massive and most luminous star that has a visual magnitudes between about −3 and −8, the temperature range from about 3,400 K to over 20,000 K. its element are different from less luminous stars. It shows helium and nitrogen at the surface due to convection of these fusion products to the surface, helium is also formed in the core and shell by fusing hydrogen and nitrogen. They contain carbon-13, lithium and s-process elements and also enriched with oxygen.

Which statement best explains the process of cellular respiration?

Answers

Answer:

Cellular respiration is the process by which organisms use oxygen to break down food molecules to get chemical energy for cell functions. Cellular respiration takes place in the cells of animals, plants, and fungi, and also in algae and other protists.

Explanation:

Because :)

Is there life on Mars?

Please help ASAP!!! Will give brainliest!!!!

Answers

yes!!!!!! there is life on mars but it is kind of an opinion answer

Answer:

no there is no life but there is proof that life could have lived there

Explanation:

To date, no proof of past or present life has been found on Mars. Cumulative evidence suggests that during the ancient Noachian time period, the surface environment of Mars had liquid water and may have been habitable for microorganisms.

What conclusions can you make from the above amino acid information?what animals are related more?

Answers

From the given amino acid information, it can be concluded that animals that share more amino acids in their proteins are more likely to be closely related.

What is amino acids?

Amino acids are organic compounds that serve as the building blocks of proteins. They are made up of an amine group (NH2) attached to a carboxyl group (COOH). Amino acids play a critical role in the human body by being involved in many processes such as metabolism, cell signaling, and transport of molecules between cells. They are also essential for the production of enzymes, hormones, and other proteins. Amino acids are classified as either essential or nonessential.

or example, mammals and birds share more than 80% of their amino acid sequences, indicating that they are closely related. Insects, on the other hand, share only around 70% of their amino acid sequences with mammals and birds, indicating that they are more distantly related.

To learn more about amino acids
https://brainly.com/question/3535479
#SPJ1

First To Answer Correctly, Gets Brainliest!!!! Connective tissue is present in bones, and blank, muscle tissue makes up muscle, nerve tissue transmits blank and forms nerves, and blank tissue lines organs and covers the body.

Answers

Answer:

what

Explanation:

Answer: uh I'm going to say B).

Explanation: Hope this helps? .-.

How has technology changed the way biologists study living things?

Answers

Answer:

It has allowed them to share their information amongst the other biologists and they can study more and discover more and more facts due to the increasing level in/of technology.

Explanation:

occlusal radiographs can be used for a. checking bone levels between the teeth. b. locating retained roots of extracted teeth. c. detecting decay. d. checking for infections at the apex of the teeth.

Answers

The correct option is B ;  Locating retained roots of extracted teeth . Periapical/occlusal radiographs are used to diagnose or confirm pathology, as well as to evaluate dental development, dento-alveolar trauma, deep carious lesions, periapical pathology, and oral involvement of systemic disease.

Adult patients' occlusal radiographs are taken using a size 3 film or phosphor plate, whereas horizontal bitewings radiographs are taken with a size 4 film or phosphor plate.

Occlusal X-rays are used to detect additional teeth, teeth that have not yet broken through the gums, jaw fractures, a cleft palate, cysts, abscesses, or growths.

Learn more about to  teeth  visit here;

https://brainly.com/question/29322193

#SPJ4

What are smaller molecules from which an enzyme molecule is made

Answers

A big molecule that catalyses a biological reaction is known as an enzyme, and most often this molecule is a protein.

Are enzymes smaller molecules?

One or more polypeptide chains of amino acids, often known as big protein enzyme molecules, make up a protein enzyme. It is crucial for enzyme specificity that the amino acid sequence defines the distinctive protein folding patterns.

A big molecule that catalyses a biological reaction is known as an enzyme, and most often this molecule is a protein. As a result, the enzyme lowers any energy barriers that are preventing the reaction from occurring rapidly and easily, which speeds up the reaction.

A type of polypeptides known as enzyme molecules have shapes that mostly dictate how they work in an organism.

The tiniest and most basic building block of matter is the atom. There is a nucleus and electrons surrounding it. When two or more atoms join to create a molecule, they are bound together by a chemical bond. Molecules are chemical structures.

To learn more about enzymes refer to:

https://brainly.com/question/1596855

#SPJ1

1) Currently, which event having the greatest effect on the entire interconnected ocean ecosystem?(1 point)


A tsunami


B hurricane


C plastic pollution **


D oil drilling


2 )) Of the following disturbances, which can only be categorized as extreme (i. E. , could not be considered small or medium in scale)?(1 point)


A hurricane flooding in several cities in Texas


B volcanic eruption in the middle of the ocean


C rapid glacial retreat due to climate change


D wildfire across several counties in California **

Answers

The answer to the given question 1 is option c) plastic pollution and question 2 is option d) wildfire across several counties in California

Plastic toxicity The buildup of plastic objects and particles in the environment that negatively impacts people, wildlife, and their habitat is known as plastic pollution. Depending on its size, plastic garbage is separated into micro, meso, and macro trash. An unplanned, uncontrolled, and unpredictable fire in an area of flammable vegetation is known by several names, including wildfire, forest fire, bushfire, wildland fire, and rural fire. A wildfire may be more precisely referred to as a bushfire, desert fire, grass fire, hill fire, peat fire, prairie fire, vegetation fire, or veld fire, depending on the type of vegetation that is present. Several natural forest ecosystems depend on wildfire. Wildfires are separate from managed burning, which is a good human use of wildland fire, even though controlled burns have the potential to turn into wildfires.

To learn more about wildfires click here

brainly.com/question/2026716

#SPJ4

The answer to the given question 1 is option c) plastic pollution and question 2 is option d) wildfire across several counties in California Plastic toxicity The buildup of plastic.

wildfire objects and particles in the environment that negatively impacts people, wildlife, and their habitat is known as plastic pollution. Depending on its size, plastic garbage is separated into micro, meso, and macro trash. An unplanned, uncontrolled, and unpredictable fire in an area of flammable vegetation is known by several names, including wildfire, forest fire, bushfire, wildland fire, and rural fire. A wildfire may be more precisely referred to as a bushfire, desert fire, grass fire, hill fire, peat fire, prairie fire, vegetation fire, or veld fire, depending on the type of vegetation that is present. Several natural forest ecosystems depend on wildfire. Wildfires are separate from managed burning, which is a good human use of wildland fire, even though controlled burns have the potential to turn into wildfires.

learn more about wildfires  here:

brainly.com/question/2026716

#SPJ4

What is the role of cellular respiration in waste-water treatment?
don't use g o o o g l e
please

Answers

Tabasco is good sauce.

What is the book "microbiology with diseases by body system 5th edition" discussing?

Answers

"Microbiology with Diseases by Body System, 5th Edition" is likely a textbook that is used in a course on microbiology, with an emphasis on the relationship between microorganisms and human disease.

The book likely covers the basic biology of microorganisms, including bacteria, viruses, fungi, and protozoa, and their role in causing infections in different body systems. The text may be organized by body system, with chapters devoted to specific diseases caused by microorganisms in the skin, respiratory, cardiovascular, digestive, urinary and reproductive systems, as well as the nervous system. The book is likely to include information on how microorganisms cause infections, how they are transmitted, and how they are diagnosed, treated, and prevented.

The fifth edition of the book probably includes updates and new information on recent advances in the field of microbiology, such as new organisms, new diseases, new diagnostic methods, and new treatments. It may also include new information on the epidemiology of diseases, the mechanism of pathogenesis, and the host response to infection. It may also have new sections on emerging and re-emerging diseases, the role of microbes in chronic diseases, and the impact of antibiotics on human health and the environment. Additionally, the book may include new pedagogical tools such as case studies, problem-based learning, or interactive multimedia that will help students to understand the material and apply it to real-world scenarios.

Learn more about microorganisms  here:

https://brainly.com/question/6699104

#SPJ4

Which of the following is true about drug therapy?Immersive Reader
(1 Point)

A.It is usually accompanied by electroshock treatments.

B.It involves four main types of psychoactive medications.

C.It is rarely effective without surgery.

D.It relies mostly on the placebo effect.

Answers

Answer is the letter B

Answer:

definitely d it relies mostly on the placebo effect

Which of the possible examples below would most likely lead to a change in the cell theory? A Scientists find life on Mars that is not made of cells. BScientists identify a cell organelle that practices the process of photosynthesis. C Scientists determine that an organism is living if it is made of twenty structurally-identical cells. D Scientists gather life from a volcano that is composed of cells which are very different from humans.

Answers

Answer: Probably B?

Explanation:

The possible examples below would most likely lead to a change in the cell theory: Scientists discover life on Mars that is not made of cells, i.e., option A, despite the fact that the cell theory states that all living organisms are made of cells.

What is the significance of the cell and its importance?

Cell theory explains that life is made up of cells, but If scientists were to discover life on Mars that did not fit this definition, it would challenge the current understanding of the cell theory and the discovery of life on Mars that is not composed of cells would indicate that the cell theory is not universally applicable.

Hence, the possible examples below would most likely lead to a change in the cell theory: Scientists discover life on Mars that is not made of cells, i.e., option A, despite the fact that the cell theory states that all living organisms are made of cells.

Learn more about the cell and its importance here.

https://brainly.com/question/30046049

#SPJ6

It is unethical for a doctor to _____.

release patient information without consent
use genetic testing to diagnose genetic disorders
release patient information with the consent
treat patients with genetic disorders

Answers

Answer: release patient information without consent

Explanation:

The information obtained from patient during the process of diagnosis should be kept under confidentiality between the hospital staff or doctor and the patient. The information can be disclosed without patient's consent in two conditions- if the disclosure is necessarily required by law or in case of public interest. Except these two conditions if the information is disclosed without the patient's then the practice will be considered as unethical.

Hope this helps have a wonderful day!

A - Release information without the patient’s consent. - HIPPA laws violated

colorblindness is a sex-linked trait. suppose a colorblind male and a female with no recessive alleles for colorblindness have children. what is the probability they will have a colorblind son? a colorblind daughter? explain each case.

Answers

There is a 50% probability that each daughter will be colorblind and a 50% chance that she will carry the gene.

Based on these findings, we would predict that 50% of their sons would have red-green color blindness, whereas none of their daughters would (although 50% of these daughters would be carriers for the allele).

A newborn typically has two X chromosomes (XX), while a male has one X and one Y chromosome (XY). However, a kid with Klinefelter syndrome is born with an additional copy of the X chromosome (XXY). The X chromosome, which is found in everyone, is not a "feminine" chromosome. A Y chromosome indicates that the person is a guy.

Learn more about colorblindness Visit: brainly.com/question/1601607

#SPJ4

The probability of having a colorblind son and colorblind daughter will be 0% and 0% respectively for both.

Colorblindness is a recessive X linked disease. Since males have only one X chromosomes, they are hemizygous for the disease and they show symptoms if the recessive allele is present on the single chromosome.

In the given question, male is colorblind(\(X^{c} Y^\)), which means he carries the recessive gene for the disease and the female has no recessive alleles (XX). Since male offspring receives X chromosome from the mother therefore, no male child will carry the gene and hence probability is 0%. And since every female child receives one X chromosome from the father, therefore all the females will be carrier but will not suffer from the disease.

To know more about colorblindness, here

brainly.com/question/291440

#SPJ4

Red blood cell production is regulated by the hormone.

Answers

Red blood cells (RBCs) production is regulated by the hormone erythropoietin (EPO).

EPO is a glycoprotein hormone, which is produced by the kidneys and stimulates the production of RBCs in the bone marrow. It plays a critical role in maintaining the oxygen-carrying capacity of the blood. EPO is released into the bloodstream in response to low oxygen levels, which can occur due to several factors like high altitude, lung diseases, or kidney diseases. Once in the bloodstream, EPO stimulates the production of RBCs by binding to receptors on the surface of bone marrow cells. This stimulates the cells to divide and differentiate into RBCs.

EPO production is regulated by a negative feedback mechanism, which means that as the number of RBCs increases, the production of EPO decreases. EPO is also used therapeutically to treat anemia, which is a condition characterized by a low number of RBCs. In conclusion, the hormone erythropoietin is critical for the regulation of RBC production, which is essential for oxygen transport in the body. The hormone is regulated by a negative feedback mechanism, and its production is stimulated by low oxygen levels.

To know more about hormone visit:-

https://brainly.com/question/13020697

#SPJ11

This is For Ecology
What source of water did the city of Flint, MI switch to, which immediately began causing problems?

Answers

The city of Flint, MI switched its water source to the Flint River, which caused immediate problems.


The city of Flint, MI made a switch in its water source from the Detroit water system to the Flint River in 2014.

This switch was made in an attempt to save money.

However, the water from the Flint River was highly corrosive and contaminated with lead, causing immediate problems.

The water corroded the city's aging pipes, causing lead to leach into the water supply.

This led to a public health crisis with residents experiencing health problems like skin rashes, hair loss, and behavioral issues.

The Flint water crisis is considered one of the most significant environmental disasters in recent US history.

For more such questions on Flint River, click on:

https://brainly.com/question/16385457

#SPJ11

Which animal is most likely to have an open circulatory system?

Answers

Explanation:

Arthropods are group of animals that includes insects and crustaceans. Mollusks are organism such as clams, snail and oysters.

the thymus is a bilobed body located in the _________ cavity.

Answers

The thymus is a bilobed body located in the mediastinum cavity. This cavity is found in the center of the chest, between the lungs, and extends from the sternum to the vertebral column.

The thymus is an important organ of the immune system, responsible for the development and maturation of T-cells, which play a crucial role in fighting infections and cancer cells. The thymus produces hormones that regulate the growth and differentiation of T-cells, and it is most active during childhood and adolescence. As we age, the thymus gradually shrinks and becomes less functional, which can impair the immune response.


The thymus is a bilobed body located in the mediastinal cavity, specifically within the anterior superior mediastinum. This vital organ plays a critical role in the development of the immune system, particularly during childhood. Its primary function is to produce and mature T-lymphocytes, which are essential for a robust adaptive immune response. As an individual ages, the thymus gradually shrinks and becomes less active, eventually being replaced by fatty tissue. Despite its reduced function in adults, the thymus remains essential for immune system maintenance throughout life.

To know about Thymus visit:

https://brainly.com/question/9095567

#SPJ11

classify the hypothesis about fluids on earth as falsifiable or non-falsifiable

Answers

Hypothesis has to do with a tentative explanation of a phenomenon.

What is a hypothesis?

The term hypothesis has to do with a tentative explanation of a phenomenon. It refers to the explanation that has been put forward in order to explain an observation.

Now the following are the hypothesis;

Magma leaks up from the mantle below Earth's surface and spreads out, forming a new ocean floor, thereby causing land forms above to move - Falsifiable

The Great Salt Lake is salty due to a high rate of water evaporation in the desert climate - Falsifiable

Magma erupting from the mantle below Earth's surface is hot and fluid in nature - Falsifiable

Floating in the Great Salt Lake in Utah is a lot of fun - Non falsifiable

Learn more about hypothesis:https://brainly.com/question/13025783

#SPJ1

Missing parts;

Classify the hypotheses about fluids on Earth as falsifiable or non-falsifiable.

Floating in the Great Salt Lake in Utah is a lot of fun.

The Great Salt Lake is salty due to a high rate of water evaporation in the desert climate.

Magma erupting from the mantle below Earth's surface is hot and fluid in nature.

Magma leaks up from the mantle below Earth's surface and spreads out, forming a new ocean floor, thereby causing land forms above to move.​

A student is going to be diving to collect shells. The instructor tells him to exhale as much as possible and then take a breath of air before he dives.

How would this help the student stay underwater for a longer period of time?

Answers

Answer: It decreases CO2

Explanation:

Answer:

Practice deep breathing. Before holding your breath, inhale and exhale slowly from deep within your diaphragm. By doing this, you're ridding your lungs of low-quality air.[1] Spend five seconds breathing in, then hold the breath for one second, before breathing out for ten seconds. Continue deep breathing for two minutes, and be sure that when you exhale, you push out every last "drop" of air.

Explanation:

The hyperventilation reduces the body's carbon dioxide content but does not affect oxygen content much, but the Fio2 of 100 kPa considerably increases the total oxygen content. Hyperventilation before diving enables breath hold divers to stay down longer but is very dangerous.

Other Questions
The point at which two or more lineages diverge from their common ancestor is called? the determinants of a firm's dividend growth rate include what factors? multiple select question. the debt-to-equity ratio return on equity the plowback ratio long-term assets Find the length of x in the 45 degree, -45 degree, -90 degree triangle. Show work After obtaining an understanding of internal control in a financial statement audit, an auditor has concluded that it is well designed and is operating effectively. Under these circumstances, the auditor would most likely What is M in triangle properties Which part of this excerpt shows intrinsic motivation?Mitchell is afraid that his father will punish him.Mitchell is afraid that Paul's father will punish him.O Mitchell is worried that he has hurt Ghost Wind.O Mitchell is worried about getting back to the barn.Read the excerpt from The Land.The way Ghost Wind had pulled back, I feared aligament might be torn or even his leg fractured."He all night?" asked Mitchell, on his feet now.Without looking at him, I shook my head. "Don't know.We got to get him back to the bam.""Your daddy's gonna kill me," he said solemnly, yet withno fear in his voice, just a voice of matter of fact."Course now, my daddy get t' me first, he'll do it. Don'tblame him this time if he do, though, 'cause he's gonnalose his job sure once your daddy see that horse." quantum particle of mass m is placed in a onedimensional box of length L . Assume the box is so small that the particle's motion is relativistic and K= P / 2 m is not valid. (b) Assume the particle is an electron in a box of length L=1.00 \times 10^{-12} \mathrm{~m} . Find its lowest possible kinetic energy. We can calculate the depth d of snow, in centimeters, that accumulates in Harper'syard during the first h hours of a snowstorm using the equation d = 5h.How many hours does it take for 1 centimeter of snow to accumulate in Harper'syard?hoursHow many centimeters of snow accumulate per hour?centimeters a) Find the Laplace transform of the functions below using the table of Laplace transforms and Laplace transform properties.(i) f(t)=4e 3t2e5t [3 marks](ii) f(t)=1+2t3e 4t [3 marks](iii) dt 2d 2f(t)+5 dt df(t)+6f(t)=1,f(0)=1, f(0)=1 [5 marks ](b) For each of the following functions carryout the inverse Laplace transformation, hence, find the corresponding time-domain function f(t), and evaluate the initial and final values of the function, i.e. f(0) and f([infinity])(i) F(s)= s(s2+6s+10)3s+4[7 marks ](ii) F(s)= s2 (s+2) 3s+2 [7 marks ] Please answer my question. What is the slope of the line passing through the points (-3, 4) and (2, -1)? If the focal length (the distance from the lens to either focal point F) of the lens is , which of the following is true of the horizontal distance from the lens to the image?difdi>2f Which of the following is an accurate description of the decision in McCulloch v. Maryland (1819)?The federal government had the authority to establish a national bank, and Maryland's tax was unconstitutional. After the execution of the following statement, the variable sold will reference the numeric literal value as (n) _data type. sold = 256.752 A. int B. float C. str D. currency What is the area of a rectangle with side lengths of 5 meter and 3 meter? - - 6 4 Before supplier relationship management (SRM), buyers typically spent 40% of their time on expediting orders. After SRM implementation buyers spent about:_____. Identify the horizontal asymptote of each graph Choose at least THREE (3) challengesorganizations face in executing social responsibility. Demonstratehow the challenges can be resolved. What is the product (1 6i) (-5 8i) ?PLEASE HELP QUICK!!!!! Please solve a question and explain how you solve this question in detail (formula, process, and what is questions answered clearly)If the Fed sells $50 billion in government securities with a reserve requirement of 25%, calculate the maximum change in money.