True or False: Online banking is visiting a bank branch to make deposits or transfer funds.

The topic studied under comparative cognition will be a. self-awareness.

Comparative cognition is a field of study that aims to understand the cognitive abilities and processes in different animal species. It involves comparing the mental processes, such as perception, memory, problem-solving, and decision-making among various animals.

One of the topics studied under comparative cognition is self-awareness. Researchers investigate whether animals possess a sense of self and are able to recognize themselves as individuals. This includes tasks such as mirror self-recognition tests where animals show signs of recognizing their own reflections.

Read more about comparative cognition

brainly.com/question/30734327

#SPJ4

Answer:

I think so.

Explanation:

Here's two examples which lead me to believe yes. One, when miners wear headgear with flashlights on it, they still see shadows like any other person. The only difference is that they can choose where the shadow is percieved to be by simply adjusting the light or the way they are standing. Similarly, I believe animals like fireflies would be able to as well. I am unsure of this, but based on logic, I would have to assume the answer is yes.

Answer:

the answer is yes and no im sure you could see em from a distance but you would not be able to see your own shadow

Answer: 1. Lack of access to affordable healthcare.

              2. Financial insecurity.

Explanation:

1. Lack of access to affordable healthcare: The family may not have access to affordable healthcare, which could be contributing to their health problems. Without access to regular medical care, illnesses and chronic conditions may go untreated, leading to increased health complications and financial strain. this also affects Jose's wellness as he may not be able to receive the necessary medical attention and treatment he needs to maintain his physical and mental health.

2. Financial insecurity: The family may be facing financial insecurity, which can cause stress and strain on relationships. The pressure of not having enough money to pay for basic needs, such as food and housing, can lead to feelings of hopelessness, depression, and anxiety. This can also have a negative impact on Jose's wellness as he may not have access to the basic necessities for a healthy life, also the stress caused by financial insecurity can negatively affect his mental and emotional health.

Answer:

The mountain's height changes due to the movement of tectonic plates. As the Indian plate slips under the Eurasian plate, it uplifts the Himalayas. The plate's movement can lift it up, while earthquakes in the region tend to bring it down. Mount Everest Is 8,844.43 Meters High and Is Still Growing. And it's still growing at a height of about 40 centimetres (16 inches) per century.

Explanation:

Lol (Brainliest?)

Answer:

Cause they lived in a different climate so they had to build different to protect themselves or keep them themselves warm.

Explanation:

Answer: Native Americans lived in many different types of housing. Some tribes were nomadic (they moved around) while others settled down in one place. Also, housing for a warm climate would be very different than for cold temperatures.

Explanation:

Answer:

The type of figurative language used in the bolded lines is a metaphor.

According to Edwin Lemert, primary deviance becomes secondary deviance when it is publicly labeled or stigmatized by society.

Lemert's concept of primary and secondary deviance is part of his broader theory on the social construction of deviance. He argues that primary deviance refers to the initial act of deviating from societal norms , which may be a result of various factors such as personal circumstances, social influences, or individual choices. This initial act of deviance may not have significant consequences or impact on the person's self-identity.

However, secondary deviance occurs when society reacts to and labels the individual as a deviant based on their primary deviant behavior. This labeling process can lead to the individual internalizing the deviant label and incorporating it into their self-concept. Consequently, the person may start to identify and engage in further deviant behaviors as a response to societal expectations and reactions.

In essence, secondary deviance is the result of the social response and labeling of an individual's primary deviant behavior. It is the point at which the person begins to perceive themselves as a deviant and may continue to engage in deviant actions as a part of their identity and social role.

Learn more about norms here:

https://brainly.com/question/29742768

#SPJ11

Answer:

Racism stems from a paradigm that sees "them" as substantially different from "us" in ways that are unbridgeable. This perception of difference provides an incentive or rationalization for us to use our power to treat the other in ways that we would consider inhumane or unethical if they were members of our own group.

How's this?

Answer:

Hello. You did not show the title of the article you are referring to, but we can say it affects the financial choices of individuals because they will have to make concessions and give up some products to guarantee the purchase of essential products.

Explanation:

When a population is facing product shortages, the economic decisions of individuals are strongly impacted. This is because each consumer must make concessions to buy the products they need and which are essential for survival. Often due to scarcity, these products are of lesser quality, but serve to supply those in need. In other words, consumers will have to allocate their financial resources to products they need, giving up, often with higher quality products and unnecessary products.

Answer:

What the study found was that context mattered more to people with high incomes. They were willing to pay more for a sandwich at a fancy hotel than the same sandwich at a small grocery store. People with low incomes, on the other hand, had a specific amount they were willing to pay for a sandwich regardless of the location. Those people cared more about the sandwich’s value, rather than the context of the purchase. For example, instead of choosing which shirt to buy based on the store, people dealing with scarcity would have to decide whether to pay for a shirt or for gas or for tomorrow’s lunch.        

i made a 100%

Explanation:

option 1) The independent nature of the national judiciary.

The scientific study of politics is known as political science. It is a social science that studies governance and power structures, as well as the analysis of political activities, political ideas, political behavior, and related constitutions and laws.

Comparative politics, international relations, and political theory are the three subdisciplines of modern political science.

Public policy and administration, domestic politics and governance, political economy, and political methodology are also prominent subdisciplines.

Learn more about political scientist

https://brainly.com/question/28667423

#SPJ4

A political scientist would most likely use Federalist No. 78 to illustrate which of the following?

Answer:Capitalism matches with free market economy.

oligarchy is the government by few people

autocracy one person rule

Explanation:

Answer:

Capitalism matches with free market economy.

oligarchy is the government by few people

autocracy one person rule

People in the Ghanaian Empire used salt as money since it was so highly valued by them. As a result, Option (C) is the best choice.

The Empire of Ghana (750–1068) was situated in the middle valley of the Senegal River, south of the Sahara, in what is currently southeast Mauritania, and the western portion of Mali.

The processes of political consolidation brought about by the profound economic changes that took place during the seventh century in the Sahel and Sahara areas are thought to have led to the emergence of multiple kingdoms in this region of Africa.

The Transaharino commerce was able to grow and seize control of crucial commercial routes by enriching the Empire of Ghana.

Hence, the accurate answer is option (C).

Learn more about the Ghanaian empire, from:

brainly.com/question/28757229

#SPJ1

Explanation:

Preventing divorce as a social problem requires a multifaceted approach that addresses the root causes of divorce. Here are some practical steps that can be taken to reach a solution:

1. Improve access to counseling services: Couples who are experiencing problems in their marriage should have access to counseling services that can help them work through their issues. Governments and non-profit organizations can work to provide affordable counseling services to couples who need them.

2. Provide education and support for couples: Many couples enter into marriage without a clear understanding of what it takes to make a marriage work. Providing education and support for couples can help them develop the skills and knowledge they need to build healthy, long-lasting relationships.

3. Address economic and social factors: Economic and social factors, such as poverty, unemployment, and social isolation, can contribute to divorce. Addressing these factors through policies and programs aimed at reducing poverty, creating jobs, and building social connections can help prevent divorce.

4. Encourage healthy relationship behaviors: Encouraging healthy relationship behaviors, such as communication, compromise, and empathy, can help couples build stronger relationships. Governments and non-profit organizations can work to promote healthy relationship behaviors through public education campaigns and other initiatives.

5. Strengthen legal protections for couples: Strengthening legal protections for couples can help prevent divorce by making it easier for couples to access resources and support when they need it. This can include laws that protect the rights of spouses in cases of abuse or neglect, and laws that make it easier for couples to access counseling and other support services.

Answer:

Helen

Explanation:

Answer:

helen

Explanation:

i did the assignment too hope this helps if you need more help lmk. Happy Holidays!

The planning and execution of a new president's inauguration is most likely to be organized by a joint task force made up of representatives from the Presidential Inaugural Committee, the U.S. government, and local organizations.

This task force is responsible for coordinating all aspects of the event, including security, crowd control, catering, transportation, and any other logistics that may be necessary.

All details must be discussed and planned in advance in order to ensure a successful and safe inauguration.

To know about U.S. government:

https://brainly.com/question/17204276#

#SPJ11

hope it will be helpful to you.

The delegates who wrote the new state constitution in the South were typically white men, many of whom were former Confederate officials or slave owners.

The white men were predominantly Democrats and staunchly opposed to any policies or actions that threatened their social, economic, and political power.

In many cases, they sought to maintain the racial hierarchy of the pre-war South by restricting the rights and opportunities of African Americans. For example, they often included provisions in the constitution that limited black voting rights, segregated public spaces, and prevented African Americans from holding certain types of jobs or owning property.

Learn more about constitution here:

https://brainly.com/question/29775576

#SPJ1

This question is about "Life of a Chinese Immigrant"

Answer:

b. Access to foods that he was used to.

Explanation:

As we read the text, we realized right at the beginning of the narrative that Chew did not decide to go to San Francisco because there was food he was used to, but because a man from the region where he lived in China and who was very poor, he became rich after he worked in San Francisco.

This man's prosperity was what motivated Chew to go to San Francisco and thus have access to better jobs, housing and food to which he was accustomed.

The primer 5'-acacaggatacgtgctgctcaatg-3' is a good choice for recognizing the beginning of the given sequence of interest due to its complementary base pairing, suitable melting temperature, specificity, and avoidance of secondary structures.

A suitable primer for recognizing the beginning of the given "sequence of interest" would be 5'-acacaggatacgtgctgctc-3'.

- The primer sequence is designed to be complementary to the first 20 nucleotides of the given sequence. This ensures a strong binding affinity and specificity.
- The primer starts with a 5' end, allowing it to bind to the 3' end of the template DNA during the PCR amplification process.
- The primer has a balanced GC content, which helps to stabilize the primer-template hybridization and enhance the efficiency of PCR amplification.
- The primer has an appropriate length of 20 nucleotides, which strikes a balance between specificity and stability of primer binding.
- The primer sequence does not contain any self-complementary or repetitive motifs, which could lead to non-specific binding or primer-dimer formation.
- The primer has been designed to avoid regions with potential secondary structures or high GC content, which can hinder primer binding and amplification.

Overall, this primer is a good choice for recognizing the beginning of the given sequence of interest due to its complementarity, balanced GC content, appropriate length, and absence of non-specific binding concerns.

Learn more about primer sequence: https://brainly.com/question/13939729

#SPJ11

The complete question is:

Design a primer that would be good for recognizing the beginning of the following "sequence of interest." Describe why your primer is a good one. 3'-ACACAGGATACGTGCTGCTCAATGCCATGATAGCCGGTCACAAGCTAATCCGATTATCGCGCAATTCCTAAATTCGCTAAAGCGAATCTTCAGGAAGGAACCCCGAAGGCCTTTT - 5', and so on.

Answer:

The greater the combined masses and the closer they are to one another the stronger the force of gravity would be.

Explanation:

Why we don't see that a falling apple is attracting the earth towards itself is because the greater the combined masses and the closer they are to one another the stronger the force of gravity would be.

The force of gravity react on either one or two object to pull them closer or together, and this is simply measured by the masses of the objects and the gap between them.

Due to Newton's third law of motion which states that when an object applies force on another object, the other object applies the same force in opposite direction on the first object, His third law in a simplest form states that for every action which can also be refer to as force in nature there is an equal and opposite reaction. Simply means, if object A apply a force on object B, then object B also apply an equal and opposite force on object A.

According to Maslow's hierarchy, people who have satisfied their basic requirements and have attained their full potential are self-actualized. So the correct option is (c).

A hierarchy is a set of objects that are arranged so that they are "above," "below," or "at the exact same degree as" one another. An essential notion in many disciplines, including architecture, or economics. Entities may be connected via a ladder directly, indirectly, laterally, or diagonal. Although a society that is primarily tiered might also have alternative hierarchies, the only direct linkages in a hierarchy, inasmuch as they are arbitrary, are to one's direct boss or to one of someone's subordinates. Through several links pointing in the same direction and following a path, topological linkages can extend "vertical direction" either upwards downwards.

Learn more about Hierarchy here:

https://brainly.com/question/30468651

#SPJ4

CQ

According to Maslow's hierarchy, people who have satisfied their basic requirements and have attained their full potential are:

A) emotionally health. B) mature. C) self-actualized. D) self-aware.

Answer:

A.) standards and practice

Explanation:

I'm not 100% sure this is the right answer but I hope it helps.

Answer:

D

Explanation:

Yes, they wanted all of these but D. is your best answer.

Answer:

upper society

Explanation:

always be on top

rich

verycash

Answer: Depends on what you want to do, however the highest class would be the Royalty, which is the answer I believe your looking for.

Answer:

The HDI is calculated as the geometric mean (equally-weighted) of life expectancy, education, and GNI per capita, as follows: The education dimension is the arithmetic mean of the two education indices (mean years of schooling and expected years of schooling)

Explanation:

The above statement is true, as the content area of this question pertains to the costs associated with quality control.

A technique or collection of procedures known as quality control (QC) is designed to make sure that a service or product is made in accordance with a specified set of quality criteria or that it satisfies the needs of the client or customer. QC is comparable to quality assurance but distinct from it. (QA).

Quality control is crucial to maintain the brand's reputation, stop items from being unreliable, and boost consumer confidence. In order to make sure that the services and goods meet the standards, it makes sure the company considers research and data based on evidence rather than anecdotal impressions.

Failing to control quality can result in prevention costs, which are incurred to prevent defects from occurring, as well as external failure costs, which are incurred as a result of defects that are discovered after the product or service has been delivered to the customer.

To learn more about Quality Control, click here:

https://brainly.com/question/20892066

#SPJ11

Answer:

- The proposal is approved, as it meets the ethical guidelines defined by the APA.

Explanation:

As per the given description, the ethics review committee would approve 'the proposal because it follows all the necessary ethical guidelines issued by APA(American Psychological Association).' The researchers formally seek informed consent from the subjects that they are going to participate in specific research. This displays the ethical consideration of the research in order to ensure voluntary participation from the subjects while keeping their safety and dignity as the priorities. Thus, they completely follow the guidelines, and hence, it would be approved.

Answer:

The answer is:

Explanation:

Answer:

Psychodynamic model

Explanation:

The psychodynamic model of abnormality points to repressed emotion, and thoughts from the past, or from one's childhood, as the basis or cause of the psychological illness. In this case, the sufferer replaces this repressed memories and behaviors with new ones. The major solution is for the patient to admit those repressed thoughts and emotions, and openly talk about them to an expert psychologist.

The given statement "Utilitarianism assigns a fixed moral value to actions (e.g. stealing is always wrong, killing is always wrong)" is false because utilitarianism does not assign a fixed moral value to actions.

Utilitarianism is a consequentialist ethical theory that evaluates the morality of an action based on its consequences. According to utilitarianism, an action is morally right if it leads to the greatest amount of happiness or pleasure for the greatest number of people affected by it.

Therefore, the morality of an action is not fixed, but rather depends on the specific situation and its consequences.

For instance, stealing may be considered wrong in most situations, but it could be morally justified if the stolen item is necessary to save someone's life. Similarly, killing may be considered wrong in most situations, but it could be morally justified if it is done in self-defense to protect one's own life.

For more questions like Utilitarianism click the link below:

https://brainly.com/question/29313132

#SPJ11